Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:228-e10   

Cenix:228-e10RNAiCenix:228-e10
PCR_productcenix:228-e10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST25D3.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
Overlaps_Gene T25D3.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254T25D3.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII154943155217
Overlaps_transcriptT25D3.2 Source_evidenceePCR275WS150 Sequence/Annotation Release
WB_DNA_textTH:228-e10275tggcgcttctcaacttctttccaatcggattcaaatattttccgaacattttgtcaccaaacttggattctgttttcattggagcctctggattctcgagttcttgggagatctcatcagttccatcacgaagacgttcgagaagagattgttcaaatttatatttcaatggctccggtgctgttgaatcttccatatcctgttgtttacgggccgcttcattcaattccagtccgatccattctgcttctctctctggaatcacaaaatcagcg