Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:233-c12   

Cenix:233-c12RNAiCenix:233-c12
PCR_productcenix:233-c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZK1320.1 Source_evidenceePCR275WS150 Sequence/Annotation Release
Overlaps_Gene ZK1320.1 Source_evidenceePCR275WS150 Sequence/Annotation Release
Chunk_score Abs_score254
Max_abs_score254ZK1320.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII96569179657191
Overlaps_transcriptZK1320.1 Source_evidenceePCR275WS150 Sequence/Annotation Release
WB_DNA_textTH:233-c12275tccaaaaactggaaacccaatggaaaggagtaacaatccgttacattccatttttcctcggagccgtcatgaaagaatcaggaaatcgtcctccagcaatgctcccagctcgatcaattatgatgatgactgatttgaagcgaactgcaaagttctgggatattccattgactccaccaccattgttcatggaatggatcaaaaagtaccgtactactggagcaatgaaggttttgttggttttgcaggagcaggataaggagctgatgctccga