Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:235-b10   

Cenix:235-b10RNAiCenix:235-b10
PCR_productcenix:235-b10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY37E3.3 Source_evidenceePCR92WS150 Sequence/Annotation Release
Overlaps_Gene Y37E3.3 Source_evidenceePCR144WS150 Sequence/Annotation Release
Chunk_score Abs_score123
Max_abs_score123Y37E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI20644702064613
Overlaps_transcriptY37E3.3 Source_evidenceePCR144WS150 Sequence/Annotation Release
WB_DNA_textTH:235-b10144tcggtcttcgtcgctactgttgccgaagaatgcttctggctcacgtggatctcatcgagaagcttctcaactaccatccgctggaaaagtaatcggagcccctttcaattgttgttgtttttctgttttgttgtggccgaatct