Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-b5   

Cenix:24-b5RNAiCenix:24-b5
PCR_productcenix:24-b5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F35H10.4 Source_evidenceePCR575WS150 Sequence/Annotation Release
Chunk_score Abs_score512
Max_abs_score512F35H10.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV83061238306791
Overlaps_transcript F35H10.4.2 Source_evidenceePCR575WS150 Sequence/Annotation Release
F35H10.4.3 Source_evidenceePCR575WS150 Sequence/Annotation Release
F35H10.4.1 Source_evidenceePCR575WS150 Sequence/Annotation Release
WB_DNA_textTH:24-b5669cccattgtgctccatctcttcttattggacttatcaatatgttcatgatgaaggatcgtaatgccggatttgtcgtagacggtggaaaagttaatggagaatatagagaagttgaaacttgttatctttctcaatggtatccaggccaatctgttattgaaatgattttggtagttattgctgtcatttgtgttccagtaatgttgtttggaaaaccaatccatcatgttatgcaacaaaagaaaaaggcaaaggaacttcatggaaacgcggtatgtttattcgcaatttaaattttagaaccttcaaacttttcagactgtccgtgcaaatgttgtctctgatagcagtgaaatagttttgaacggaggatcaaagaaagaaggagcagctcatgaagaacacgggcacggaggacacgaagatgaatccttcggagatattatggttcatcaagctattcacactattgagtatgtactcggatgtgtatctcacactgcctcttatcttcgtctttgggctctttctcttgctcacgctcgtatgttggaaattttaagctacatatcagttatttttcaaattacagagctctctgaagtcttgtggcacatggtgttcgttaccggaggtcttggaatttctggaactgctggattcattgca