Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-c7   

Cenix:24-c7RNAiCenix:24-c7
PCR_productcenix:24-c7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS F41E6.4a Source_evidenceePCR625WS150 Sequence/Annotation Release
F41E6.4b Source_evidenceePCR625WS150 Sequence/Annotation Release
Overlaps_Gene F41E6.4 Source_evidenceePCR625WS150 Sequence/Annotation Release
Chunk_score Abs_score604
Max_abs_score604F41E6.4
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV86158528616476
Overlaps_transcript F41E6.4b Source_evidenceePCR625WS150 Sequence/Annotation Release
F41E6.4a Source_evidenceePCR625WS150 Sequence/Annotation Release
WB_DNA_textTH:24-c7625gccaatcgtcaatcggttattcttcgacttttaacattctgcgtagaacatcactcattttcaatgcgacaacgatgtgtatcaaatgatttgatgaataaggttcttgtattgctcaagtcgaagcattcattccttgtcttgtctgcactgaagcttcttcaacgtgtggttactgtcaaagatgataaatacattcggtacattgtgaaggagaaggttctggacccagtcatggaatgtttccgtaaaaatggcaaccgctataacattatcaactcttctgtcttgcatttgttcgagtttgtgagaagcgaagatgttcgtccactcataaaatatgttgtcgaaaatcatatggaagtcgttgattctgtaaactatgtaaaaacattcaaagagatcaagattcgatacgaccaacatcgtgatcgtgaagaaacgatgagcgttcgttctgaggacaactcattggcaagtccacgaagtttccgcaaggatcgtaatgaagatcaatggtttgatgaggatgaagacctggaagttggaacaatgcttgaatcaatcgaaaaggactcagtcgcagtgtctcccaaaaaagaagaggctggacagaggaagactg