Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:24-f8   

Cenix:24-f8RNAiCenix:24-f8
PCR_productcenix:24-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF44F4.11 Source_evidenceePCR538WS150 Sequence/Annotation Release
Overlaps_Gene F44F4.11 Source_evidenceePCR538WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRII1091938710919969
F26E4.8 Chunk_score (3)
C47B2.3 Chunk_score (3)
Y19D2B.1 Chunk_score (3)
Overlaps_transcriptF44F4.11 Source_evidenceePCR538WS150 Sequence/Annotation Release
WB_DNA_textTH:24-f8583caatcaccgcttcactcagatttgacggagctctcaacgtggatctcaacgagttccagaccaacttggtgccatacccaagaattcatttcccattggcctcttacactccattgatctctgccgagaaggcatatcacgaggctctgtctgtcaatgacatcaccaatagctgcttcgaaccagcaaatcagatggtcaaatgtgatccacgcaacggaaagtacatggctgtctgtcttctgtaccgcggagatgttgtgccgaaggatgtgaacactgcaattactgccatcaaaaccaagagatcagttcaatttgtggattggtgcccaactgggttcaaggttggaatcaactaccaaccaccaactgtggttccaggaggtgatcttgccaaggtgccacgcgccgtgtgcatgctctccaacactacggctatcgccgaggcctggtcccgcctggactacaagtttgacttgatgtacgccaagcgcgcctttgttcactggtaagattcgagttgtttgaaacacaaaatatcgattatttgcaggtacgtcggagaaggaatggaagaggg