Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-d8   

Cenix:242-d8RNAiCenix:242-d8
PCR_productcenix:242-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score Abs_score270
Max_abs_score270T23D8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99883489988781
Overlaps_transcriptT23D8.5 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textTH:242-d8434gcaatcggactgtttggatttatcatttgtggccctaaagagggccgttgggttcggtggttgttgcatggaagcgggaggacaattgaaattatcctccgaatccgtacagggttcttccttgtctcttcagagcatagacaacgtccatggctgtgacggtcttcctcttggcgtgctcgcagtaagtgacggcgtctcggataacgttctcaaggaacaccttgagaactccacgagtttcttcgtagatcaatccagagatacgtttgactcctcctcttcttgctagacggcgaatggctggcttcgtgattccttggatgttgtcccgaaggactttacgatggcgcttggcacctccttttccaaggccttttcctccctttccacgtccggacattgttgagtgattggctgaagactcacgaatg