Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e4   

Cenix:242-e4RNAiCenix:242-e4
PCR_productcenix:242-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54E12.5 Source_evidenceePCR338WS150 Sequence/Annotation Release
Overlaps_Gene F54E12.5 Source_evidenceePCR338WS150 Sequence/Annotation Release
Chunk_score (3)
Map_statusUnique_ePCRIV1134042911340845
F17E9.13 Chunk_score (2)
B0035.7 Chunk_score (3)
F08G2.2 Chunk_score (3)
ZK131.10 Chunk_score (3)
F55G1.10 Chunk_score (3)
T23D8.6 Chunk_score (3)
H02I12.7 Chunk_score (4)
F35H10.1 Chunk_score (3)
Overlaps_transcriptF54E12.5 Source_evidenceePCR338WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e4417ccaagtcacgctcatcaagagctggacttcaattcccagtcggtcgtcttcaccgtattcttcgcaaaggaaactatgctcaacgtgttggagccggagccccagtctacttggccgctgttcttgaatatctcgctgctgaggttctcgagttggccggtaacgctgcccgtgacaacaagaagacccgtatcgccccaagacatcttcaactcgctgtccgcaacgacgaggagctcaacaagcttttggccggagtgaccatcgcccaaggaggagttcttccaaacatccaagccgttcttctcccaaagaagactggaggagataaggagtaagaactttcttctttaaacaaacccaccgaacccaacggccctctttagggccacaaatatccaaaaacctgacaatccc