Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e4   

Cenix:242-e4RNAiCenix:242-e4
PCR_productcenix:242-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54E12.5 Source_evidenceePCR338WS150 Sequence/Annotation Release
Overlaps_Gene F54E12.5 (3)
F17E9.13 Chunk_score Abs_score67
Specificity_index0.045
B0035.7 Chunk_score Abs_score317
Max_abs_score317B0035.7
Specificity_index0.214
F08G2.2 Chunk_score Abs_score89
Specificity_index0.06
Rel_score0.281
ZK131.10 Chunk_score Abs_score68
Specificity_index0.046
Rel_score0.215
F55G1.10 Chunk_score Abs_score152
Specificity_index0.103
Rel_score0.479
T23D8.6 Chunk_score Abs_score107
Specificity_index0.072
Rel_score0.338
H02I12.7 Chunk_score Abs_score317
Max_abs_score317H02I12.7
Specificity_index0.214
Rel_score1
F35H10.1 Chunk_score Abs_score67
Specificity_index0.045
Rel_score0.211
Overlaps_transcriptF54E12.5 Source_evidenceePCR338WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e4417ccaagtcacgctcatcaagagctggacttcaattcccagtcggtcgtcttcaccgtattcttcgcaaaggaaactatgctcaacgtgttggagccggagccccagtctacttggccgctgttcttgaatatctcgctgctgaggttctcgagttggccggtaacgctgcccgtgacaacaagaagacccgtatcgccccaagacatcttcaactcgctgtccgcaacgacgaggagctcaacaagcttttggccggagtgaccatcgcccaaggaggagttcttccaaacatccaagccgttcttctcccaaagaagactggaggagataaggagtaagaactttcttctttaaacaaacccaccgaacccaacggccctctttagggccacaaatatccaaaaacctgacaatccc