Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-e5   

Cenix:242-e5RNAiCenix:242-e5
PCR_productcenix:242-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK06C4.10 Source_evidenceePCR235WS150 Sequence/Annotation Release
Overlaps_Gene K06C4.10 Source_evidenceePCR235WS150 Sequence/Annotation Release
Chunk_score Abs_score151
Specificity_index0.159
Rel_score0.693
Map_statusUnique_ePCRV89006528901049
K06C4.2 Chunk_score Abs_score194
Specificity_index0.204
K03A1.6 Chunk_score Abs_score97
Specificity_index0.102
Rel_score0.445
T10C6.14 Chunk_score Abs_score98
Specificity_index0.103
Rel_score0.45
F45F2.3 Chunk_score Abs_score218
Max_abs_score218F45F2.3
Specificity_index0.229
Rel_score1
F07B7.9 Chunk_score Abs_score194
Specificity_index0.204
Rel_score0.89
Overlaps_transcriptK06C4.10 Source_evidenceePCR235WS150 Sequence/Annotation Release
WB_DNA_textTH:242-e5398gaggcggggaagttagagagtaggtaagagtgagtgagaacaaagataacaagacaaatgtgtccccgcagtgtctcctccttcacaccgcatagtggtataaaagggacagccaactgtccatttcttcatctcacttgtgagtcttcattcaactgcaacaatgtccggacgtggaaagggaggaaaaggcctcggaaaaggaggtgccaagcgccatcgcaaggtccttcgtgacaacatccaaggaatcaccaagccagctattcgccgtctcgctcgtcgtggtggagtcaagcgtatttctggactcatctacgaggaaactcgtggagttctcaaggtgttcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaaga