Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-f7   

Cenix:242-f7RNAiCenix:242-f7
PCR_productcenix:242-f7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene T10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRV1604509216045451
K06C4.2 Chunk_score (2)
K03A1.6 Chunk_score (3)
T23D8.5 Chunk_scoreAbs_score59
F45F2.3 Chunk_score (3)
F07B7.9 Chunk_score (3)
Overlaps_transcriptT10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textTH:242-f7360gtcaactgcaacaatgtccggacgtggaaagggaggaaaaggccttggaaaaggaggtgccaagcgccatcgaaaggtccttcgcgacaacatccaaggaatcaccaagccagctattcgccgtcttgctcgtcgtggtggagtcaagcgtatctctggactcatctatgaggaaactcgtggagttctcaaggtattcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaagagaaagaccgtcaccgccatggacgttgtctatgctttgaagcgccaaggaagaactctgtacggatttggaggataattttatctctcgatttcatacaaccaaccaaccga