Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-f7   

Cenix:242-f7RNAiCenix:242-f7
PCR_productcenix:242-f7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
Overlaps_Gene T10C6.14 (3)
K06C4.2 Chunk_score Abs_score64
Specificity_index0.102
K03A1.6 Chunk_score Abs_score109
Specificity_index0.173
Rel_score0.375
T23D8.5 Chunk_scoreAbs_score59
F45F2.3 Chunk_score Abs_score102
Specificity_index0.162
Rel_score0.351
F07B7.9 Chunk_score Abs_score64
Specificity_index0.102
Rel_score0.22
Overlaps_transcriptT10C6.14 Source_evidenceePCR312WS150 Sequence/Annotation Release
WB_DNA_textTH:242-f7360gtcaactgcaacaatgtccggacgtggaaagggaggaaaaggccttggaaaaggaggtgccaagcgccatcgaaaggtccttcgcgacaacatccaaggaatcaccaagccagctattcgccgtcttgctcgtcgtggtggagtcaagcgtatctctggactcatctatgaggaaactcgtggagttctcaaggtattcctcgagaacgtcatccgtgatgccgtcacctactgtgagcacgccaagagaaagaccgtcaccgccatggacgttgtctatgctttgaagcgccaaggaagaactctgtacggatttggaggataattttatctctcgatttcatacaaccaaccaaccga