Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-g2   

Cenix:242-g2RNAiCenix:242-g2
PCR_productcenix:242-g2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF32B6.6 Source_evidenceePCR363WS150 Sequence/Annotation Release
Overlaps_Gene (28)
Overlaps_transcriptF32B6.6 Source_evidenceePCR381WS150 Sequence/Annotation Release
WB_DNA_textTH:242-g2381ctccttcatcgaacgaccatggcccaatccgtcccaccaggagacatccaaactcaaccgggtaccaagatcgtcttcaatgctccatacgatgacaagcacacctaccacatcaaggtgatcaactcatcggctcggcgtattggatatggtatcaagaccaccaatatgaagagacttggagttgatccaccatgtggagttctcgacccaaaggaagctgtgcttcttgctgtttcctgcgatgccttcgccttcggacaagaggataccaacaacgaccgtatcactgttgagtggaccaacaccccggatggtgctgccaagcaattccgtcgtgaatggttccagggagacggtatggctcgtcgtaagaacctc