Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:242-h9   

Cenix:242-h9RNAiCenix:242-h9
PCR_productcenix:242-h9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY39G10AR.2 Source_evidenceePCR325WS150 Sequence/Annotation Release
Overlaps_Gene Y39G10AR.2 Source_evidenceePCR325WS150 Sequence/Annotation Release
Chunk_score Abs_score304
Max_abs_score304Y39G10AR.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI24045882404978
Overlaps_transcriptY39G10AR.2 Source_evidenceePCR325WS150 Sequence/Annotation Release
WB_DNA_textTH:242-h9391ggcgcacttcacctttaactaattaaatattcaccaaaaaaaattcgaaaaaattcagcatccgcctcaactgctccgagcatttttcgccgtcaatctcgacactgcccgtgtggatctccacgaccagctcgaaattcccatcgatttgctggctcgccgccggccgcaccaatcgaaacgtgcaattcgccgcggcgacccgtgttctcggccatttcaacaatgagaatagtgagagggtggtgaagcagctcaaccaggcgtgcggcacatctcagctcaacaagtatcgggccgtttacgaggagattcgtaagattgcaacggagaatcgaccggctcctggcgaagttacgatcgatgtgcggtggagcacaaaggtagcaca