Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:246-d10   

Cenix:246-d10RNAiCenix:246-d10
PCR_productcenix:246-d10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF55G1.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
Overlaps_Gene F55G1.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
Chunk_score Abs_score178
Max_abs_score178F55G1.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIV74877047487923
Overlaps_transcriptF55G1.11 Source_evidenceePCR220WS150 Sequence/Annotation Release
WB_DNA_textTH:246-d10220cagagcgtagacgacatccatggcggttacggtctttctcttggcgtgctcgcagtaagtgacagcatcacggatgacattctcaaggaataccttcaagactccacgggtttcctcgtagatcaatccagaaattctcttgactcctcctcttctagcgagacgacggatggctggcttggtgataccttggatgttatcacggagaaccttacgatgg