Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:28-g8   

Cenix:28-g8RNAiCenix:28-g8
PCR_productcenix:28-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST23D8.1 Source_evidenceePCR504WS150 Sequence/Annotation Release
Overlaps_Gene T23D8.1 Source_evidenceePCR504WS150 Sequence/Annotation Release
Chunk_score Abs_score444
Max_abs_score444T23D8.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRI99663729967172
Overlaps_transcriptT23D8.1 Source_evidenceePCR504WS150 Sequence/Annotation Release
WB_DNA_textTH:28-g8801atttacggccgctgtgatactgacaagtttggctgaatttaagtattattccgaatttttgagccccataaaaactcctactccaaagcgtcaaatagttttttatcaaagtttttgaatttagaaattttccgaaaaaaatgtacatcgagatttctaaattctttgttttatcgaacaataaaacaagtttccgtagatcgaaatataaaatatttcaagttacagaagtagtaatgacgtcacattcggtgtttcaacaattgccaacgaagttgtcctttctccaaaaaaatgccctcatcatatgcatacaacaagcggatctcatttttcattgcctcttctcagtggacgccttcctgaatgttcattaacatgtgaagctgacaatcaagtaccaatgatgtttgatggacgtgttcgacgaattcttcgaatctggacagcagcatggtctgtggcatgtttcgtgtgctctttattcactcttgtcacatttcttgttgatttatcacgattcgcgtatccagttcgaccgattttgtatctcgcgttctgttatctagcaatttctacggtttatatgataggtgagttgaattttctgttttttttaaatcagattttttagaaactaaaaatgtatttctacaggcgtagtcggtgaagatggattcgcttgtggaacgtatggatctactccaacaacacttgttacgcaaggaggagaaaatgttggatgtagtgctcttgctgttgttcattactttttcttcatgtcaagttgtgcgtggtgag