Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:30-h6   

Cenix:30-h6RNAiCenix:30-h6
PCR_productcenix:30-h6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC18E9.6 Source_evidenceePCR906WS150 Sequence/Annotation Release
Overlaps_Gene C18E9.6 Source_evidenceePCR995WS150 Sequence/Annotation Release
Chunk_score Abs_score848
Max_abs_score848C18E9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRII89721978973789
Overlaps_transcriptC18E9.6 Source_evidenceePCR995WS150 Sequence/Annotation Release
WB_DNA_textTH:30-h61593ggcgaggagagaaatgattgagaaaaagtaagagaatgaatacttcgtcgtattgtcaacagataaacaagaggacagtgagcaacgaattaaccaatgataagtccgattccgaactttccagcagccttcacgtggttaagagtacccgatagagccaaggtgaatgggagctgctgactgagacgtttttcgaatacaccaccaacagtcctgaaaacgagaatcataaatatttaaatgtttaagatgttctaaaatctcaccagttagtgtcaaagctagctctcatggttacaccttcctctggcagctcggtttgataggctagcgtggtgacggcttctccaacattggcattgcactcaaattcgactccgaacgccaagttttcattttgtttgtgatagtaagttaggtgtactcctgaaaatgcatcaatctcttttttccttctcactaacaaataaaacataccggatgccccgagtgtggcagctgcgatgaaatgatttgcagtgtatcgagctgcatacgaaagcactgagatctgtcctccaggaatattctttccatactgatataccatctcagttcccacatcaagacggggtgtaagtctccgcaaaaactgtccaaccaagataccagcttcgttgacaagatcaatgtttgccaaagtgagacccagcgtgctgagacggcctctgaaaatgcacattttaaatttgtatggttagaaataacatactttctctcaattgtggcttgcgcaccagccaattttccttgctggatttgcccttgaagttttgttcggtatattcctgaagtaaaatataaaaaatcacagaaatttcgaaaaatatcagaccaagttggtgaagtatggttgcggtagtgtttccatttacatcagtgtctccaagaagaattgggtaagcttctgccggtccaacctgaaatgattgttgaaacgaaatttttgaaaagacatttctacctgattggttcctacatatgttgctccaaatcggtatccggtgttcattgcagagagagaaagagtgtgagaaacctgaaaacatcaattttacagcattttatgaactaagaacatgttacctggaagtgcgaactcagtcctttattaaccatcagcttggctccttcgaaacatgttgggaagacatcacgagctttgcggtggagttcttcgtatgaacccggatttgtttgaggaatcggtgaggcgagctcactttctgttggtgtcgccatctgcaaaactatttttagtaggaaatttttaacaatttcaacccaaatttgaagtgaacaaacgataaaaaggaaaacatgacgtaattattcagtgtacctaaatcatatagtccacctaatttataagattgaatttggtgcgaaaactttaattacttcctgaaaaatatttaaataatcataaatatcaaaaaagttgaagaaaactacttgaaaaataataaaaccaaggttttttatttagaagggtttattcgcagcacagttaaacaacacgcaggtggcattgcggagcatcgttgtacaatg