Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:300-f12   

Cenix:300-f12RNAiCenix:300-f12
PCR_productcenix:300-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF43C1.1 Source_evidenceePCR1012WS150 Sequence/Annotation Release
Overlaps_Gene F43C1.1 Source_evidenceePCR1012WS150 Sequence/Annotation Release
Chunk_score Abs_score865
Max_abs_score865F43C1.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII42121494214405
Overlaps_transcriptF43C1.1 Source_evidenceePCR1012WS150 Sequence/Annotation Release
WB_DNA_textTH:300-f122257ttcatctcacgaatttgaggtttttgaaagtaagggggctttaaattgttgttttcaactcggaattaaagtgatgaccaagtctatatgcgttttcggtttttcactgattttttaaaaaatttcaaaagagtctaactctaaaactaggagttggcataatatcgtgttcaagaaaaatgtttttgaaaaataaagctacgaataatttttattgttttttatcttttaaaacatccagtaaagtagaaatataagttcaaacaagtggttaaatttttctaaaatcaacttttcaacaaatctaaatttttaaagtttggaatttcgccaaatttttcactaaaaattagaaaaccgaaaatatgttacagtgttatatttatatgtttgacttatcttaagcatattttaagacaatatagaatttataaaaactcccaatatttcaggtaattcattgcgaacgtctccaattgtcaagtctacatttgagtggagaaagtttgactcatgtatatgcagatcataattgtaggctcaaaatcatatattttatttaatttattaaatattacagtacttgattccctggtcgtgatgcctcttccacaaaacctacaaactctttcactttctttcaatcactttcgaaatctgccagattggatatcagattgcccgaatttgacatttctccgagcaaataataatagccttgtggcactgccagagaggttagtttgagattaaaggtacaagtaaatttaagaatttctaaaaatttcagaatattctactcccaatctcttcgttcaatatttgcatttatcaatgaaatcgaacatattccggattttggagaagaaaattgtctagaaacattaatactttataagaataaactgtcctcacttcccaaacatttcttcagtatattgccaaggtaagttatcactgaaatttgaaaattcaagttttaaaattttagattacgacagctcaatatttcatcgaattttatagaattattgccatattttgatggttcatcgttttgcagactacaagtaagtaaagtttttaatttggaatactagaatcttcaagaatggccaaaaaaaaagatacaaatgtaggcccagtaggcacacgtataggcacaaagactcacatgtaggcacagtagccacgcctgtaggcacgatgtgcgcgcttgcaggaatagtaggtatgcgtattggcccaataggcactctagtaggctcagtaggcgcgcatataggtatgtaggcgtgctcttcggcgctttgtgaaatccctgttatgagtaactcctaaagttgtttggtcaaaagtttggctaccgcaagctacgtccaagaaagggaaaaaagctggcagattttagtgtgcctcttgtgcctacgagcgcctactgtgcccactgagcctacaagcgtgcctatggtgactaagcgtgtgcctacttgacctaaatcaaacgcctgtagaaaacgcaagtttctagcatgtttcagaaatcaaacagtaagagtatttgagaaactaaatttaaaaaacctaaattaactttttaaatttctcaatgtttccagatcctacgttgcgccaacaactatttaacagagaacagtgtgccagtgattgtaaatatgaaacatttaaaaataattgatctcagtcataatcgattaaattctttcgatgacagtgctctcagctctttggagcttctggaagatctcaatttaagttcaaaccgcctgacaagacttgctgattgtttggctcttttgccatgtttacaagtgctcagagctcattcaaatcaacttgttcatgttccagaatttcgagcatctaatcagttacatgtgagtttttgagctctacgattttcttagaaaattgttttaaatttccaaattttcaatatttccagacaatagatgtctcatcgaataacatctcacttggaactctccaattcaaagctccgccaaatttacgccatttcgatgtgacgtgtaactctggagatttcgatacggaaaacttcccggaaaacgcaaaaatgcattcaaaaatgaatacgataaatatttccgaagggtcacaaaatctctttggctttcaaattggagtctcaggcagtcgaggaatgaaaaataagtaagaaacgttttttaagttttagttgaaattggaaacaagctaactgttctacgtgcct