Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:300-f3   

Cenix:300-f3RNAiCenix:300-f3
PCR_productcenix:300-f3
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R07E5.17 Source_evidenceePCR408WS150 Sequence/Annotation Release
R07E5.3 Source_evidenceePCR1114WS150 Sequence/Annotation Release
Overlaps_Gene R07E5.17 (3)
R07E5.3 Source_evidenceePCR1117WS150 Sequence/Annotation Release
Chunk_score Abs_score1033
Max_abs_score1033R07E5.3
Specificity_index0.738
Rel_score1
Map_statusBest_ePCRIII44038394406013
Overlaps_transcript R07E5.3 Source_evidenceePCR1117WS150 Sequence/Annotation Release
R07E5.17 Source_evidenceePCR408WS150 Sequence/Annotation Release
WB_DNA_textTH:300-f32175aattccaacaaccacattttcacagatatttccattttgaaaaggtattctacattccatatttcccttggatttatgaaaacattcagacatttcttcagaattttcccaaaagttataagaaaattgagtagaagctagacactccgatgatttgataacagtgaaacatttatccgaagattgaattattgaacaattccatttcattttactgaaattctattaatttttctgtcaaaaaacaattattgtgataccgggccaactgaggtgttacaactgggtactgtagatcatcaagaggaaatgttgaagttttcgagctatctgttggtttttcaaaaaaatcttgaaagaaagaatcaacaagagtaggaaaacctccaactacgcgaaacggatcaaatctagaagaaataaaccgtttttttagaatccgaaatatgtacataccccaggttaattggaatttcccaattaccaagccatttataacatagaagaaaaagtaaccagttgcagataataataaatttcatctaaaacgtatatattgctaggaacacatttttccatgacccctttctcttcaattccttcgtttccatggtaattccaattttagttgccgaaatttggtagtgtgcaattgcgcccccttgagatacgcacgcggcacgcttcgcgtagaacagaatttattactcgaattttgaacggtattcgcttctgttttcatgtttttcatgtttttttcttgaaatatataatttgtttcagcttaaatcatttgaattactatcataatttattgtttttctattagaatagcgtttacaaccactgctatttgaaattatccgtttcgtcgcattttactcccagttcttgacatattcgtattatgtttcaggtaatgtcgagcagcacgaaaacgttgtctcaaacttacggaccacgtcctcagagcttcagtctagatgaagccggagaaagatactacatcggttctgaaataggtgcctatcttcgtctccatcgtggaactctctacaagaagtatccattattatggagaaaagttgcaacttcggatgacaaagacaagctgaagcaaattgcaatgtcaaatgcttttttgcatactaatatcatgtgagtataaaaaccaaagtgtcaaatttcattcggcaagtattttacaggctgctgagagcgcatgaagtagatgagcttctcgatggttccgaagaaaagtaccgagcggctggagcagcgccttcaactccaagaactgaaggagcttctagaactgtcgctaaaactcctgcaactggatgggcaggacaacaagtcaccagcggttcacatcatctcgaatccgttccatgttcttgtccgatagctcattctagaggaagaatgaagcatcgtgaattagtatattcagcagaagatttagaaatgtcgaaacgagtgatgaaaaatgctgaggaaggagaagatcttgtgccaattcgattggatatggagttggatggaatcaaacttcgcgatacgttcactttcaataaaaacgagaaaatgatcactcccgagatgattgccgaaattatgtgtgaagatcttgatctaccattggcagttttccagcctgctattactgcagcaattaatcagcagctcgaagcttctacagaagcgccaccattggatgtgaacatttgtgatcagagagccgttctcaagttgaatattaatgttggaaaccagagtttggttgatcaattcgagtatgttggaaatgctaaagactgacaattcattttaacttcaggtgggatatgtcggatcctaataacagcccggaagagttttcacgaaacatctgcaaagagcttggcctcggtggtgaatttatgtcaggaattgcatattcaattcgcggacagttacaatggaatcaaagaacatatgcgttttcagaaagcccactggccactgttgattgcccgttcaggtaaatttgatatgaaataatgaatttttgcaaaccaatgctattcagaacatcatctgaagtcgaatcttggggtccattcctcgaaactttaaccgacgctgaaatcgaaaagaagatgcgtgatcaagacagaaacacgagaagaatgc