Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:300-f9   

Cenix:300-f9RNAiCenix:300-f9
PCR_productcenix:300-f9
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.7a Source_evidenceePCR729WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.7 Source_evidenceePCR955WS150 Sequence/Annotation Release
Chunk_score Abs_score742
Max_abs_score742T26A5.7
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64510836453018
Overlaps_transcript T26A5.7b.2 Source_evidenceePCR745WS150 Sequence/Annotation Release
T26A5.7a Source_evidenceePCR745WS150 Sequence/Annotation Release
T26A5.7b.1 Source_evidenceePCR955WS150 Sequence/Annotation Release
WB_DNA_textTH:300-f91936tacggctcgttattgagatttgtttcaggtttgattcgctgtgagaatgagaaaaggcggttgaaagagacgaagtaatgagaggattgggcacgagtgccgtggaaaatatgagaaaatgaagggaattacagtagtatactcgtgaaggtaaatgaacatttgaaatggattgagcagatcgaagagatgttgtggagcaacatattatgtgttcacaagccatggattcttggcaatcgtctctgctgaacgatctccataatcgtagagaagctcttctccttgtgcgatttgacgcctggcgacgagaatcaggtgatgcgacccatcgatttccaccacctggaatgtttagttttggaattgttatttacatttttttaatttatcaaagactttcttaataaatttcaaattttgaaatgctcactttcgttttgagattcggccttaacacggaatgattgatgagtcgtcctttccatggagattcttttgtcgcatcgatacaccattttttattgttgtgctcaaaaaagtacatgtaggatccgatttcctcatcattcgaatattgttcttctatcacttttgcttccgagtactccatcataacacctagaatactttttaaaaacaatattacaacaattatctgtgttatctacatacctctgtattcgacaacaaagtctcctttttcaaagttaactttcgttcgaattcctcgccccttcacaacatctttgtacacttcaagaagtcgttcattagtccccttgagtacggtatcgcgaagagcatgtttagcttcatcgctaatttgcttgctcgtcttccgattacttcgccgcacttggaagaattctgtgattttatggtttgagacatctttcaccgacactccttttctgaaagaaaaactatttggaaattgaagttttcagcttggacaatttctgtgaatatgttgtgaattcaattagaaatattgaagtttttaaacgttctattacaatccctcttgtcactaatcaatcatacctgctccttgtgtttttcgacggtgtcattcttcctgaagatgaagagtgtgaagccaaagacgatggattttcggagttctcaatatcactagatggtgacgctgctgcggcacgatcctttcgcattctactcgttgccagcttcttcgcggcaactttcatccttcgagtgacaccgctgaaaaaataataaattttgtagggtgaggagaatagtaaaaatagagaaatttataaagaagcaaaagaggtgtcatagaaataatagaaatattcgcccacaatttattttttttgttttgaaatggttgggtaaaaatattataatgtgttgtttcaaaaacccagatattcaatatgatttcatcggtcctgaatactgtaattgaaaatggaaaagccatcttggatgtacctgaaaaagtagttgggaagagggtaacagaggaaattgaagcgggcagagagatgcgtaaagcagattgaatgggttttcggaggaatattttttttagaaagtgaaggtttctattgtgaaaagggtgggctttcaccgattccgttgaatttccaaatatcaaaagaccgagtagaacatcatcattaagatatttatccacatttcgtgaataacctcattagaaatcaaattcagtggtttttgacgagagctgagcacaaagaacaatgtcgtgcacacgcgactaaattcaaatggtgtgcagtcatatggttttggcgggaagtgccgtggagcgttattgcactcacggtagatgtcggtggttggtgtaaaaaatggtggattgaaattatggaattgaactttaaaatgtatatttccgtaataatagatacacttattgggctcgtaaaattaaacagaa