Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:301-e6   

Cenix:301-e6RNAiCenix:301-e6
PCR_productcenix:301-e6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene C34E10.6 Source_evidenceePCR1474WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII52286415230223
Overlaps_transcript C34E10.6.3 Source_evidenceePCR1443WS150 Sequence/Annotation Release
C34E10.6.1 Source_evidenceePCR1474WS150 Sequence/Annotation Release
C34E10.6.2 Source_evidenceePCR1443WS150 Sequence/Annotation Release
WB_DNA_textTH:301-e61583attctggttttaaggtctctgccaaggctacagctgctaacgcttccggacgcattgtcgctgtcatcggagccgtcgtcgacgtccagttcgatgagaaccttccaccaatcctcaacggtctcgaggtagtcggacgttccccaagactcattcttgaggtctctcaacatctcggagacaatgtcgtcagatgtattgctatggacggaactgaaggacttgtccgtggacagccagttgctgacaccggagatccgattaagatcccagtcggaccagaaactcttggccgtatcatgaacgtcattggagagccaattgacgagagaggtccaattgcatccaagaacttcgctgctatccacgctgaagctccagaattcgtcgaaatgtccgtcgagcaggagattcttgttaccggaatcaaggtcgtcgatcttcttgccccatacgccaagggaggaaagattggacttttcggaggagctggagtcggaaagactgtgcttatcatggagctcattaacaacgtcgccaaggctcacggaggttactctgtgttcgctggagtcggagagcgtacccgtgaaggaaacgatctctaccacgaaatgattgaaggaggagtcattgatctcaaggttagtaggaaaaaatggttcatggtatttaaataaacaatttatagggaaagaactccaaggtatctctcgtatacggacaaatgaacgagccaccaggtgcccgtgctcgtgtgtgcctcaccggtctcactgtcgccgagtacttccgtgaccaggaaggacaagatgtgcttcttttcattgacaacattttccgtttcacccaggctggatctgaagtgtccgctcttctcggacgtatcccatccgctgtcggataccaaccaacccttgccactgacatgggaagtatgcaagagagaattaccaccaccaagaagggatccatcacatccgtccaggctatttacgtacctgctgacgatttgactgatccagctccagctaccacattcgctcacttggacgccaccactgtcttgtcccgtggtattgccgaattggctatctacccagctgtcgatccacttgactccacctcccgtatcatggaccccaacgttgtcggacagaaccactacgacattgctcgtggagttcaaaagatcctccaagattacaagtccctccaagatattattgctattcttggtatggatgagttgtccgaggaagacaagcttaccgtttcacgtgcccgcaagatccaacgtttcctttcccaaccattccaagtcgctgaggtgttcactggacatcaaggaaagttcgtatcactcgaagagacaatccgcggtttcaccatgattctcaagggtaagaatatttaaacgttgaaaacattaaaattaaatcaattttcaggagaactcgaccaccttccagaagttgctttctacatgcaaggaggaatcgatgatgtgttcaagaaggccgaagaactcgccaagcaacacggaaattagttttattttttttgttataacgccgacactt