Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:301-g7   

Cenix:301-g7RNAiCenix:301-g7
PCR_productcenix:301-g7
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F48E8.5 Source_evidenceePCR1469WS150 Sequence/Annotation Release
Chunk_score Abs_score1364
Max_abs_score1364F48E8.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII54509545452617
Overlaps_transcript (4)
WB_DNA_textTH:301-g71664catgttcattgtcttctccttccacttgagaacttggccacagtcgaggagaccgtggtccgtgacaaagccgttgagagtctccgcaaaatcgccgacaagcacagctcggcctcattggaggagcatttcgtgccgatgctcagacgtttggccactggagactggttcacatcccgtacctcggcttgtgggcttttctctgttgtttatccacgtgtcagtccagctatcaagtcggaattgaagaggtgagaattaagaaaagaataactaaagcaatctaaattaattattttcagcatgttccgaaccctgtgccgtgatgacaccccaatggttcgccgtgctgctgctgcaaagctcggagagttcgcaaaggtgtttgagaagactgccgtcatcgagggtctccactccagtctcactgatcttcatgttgatgagcaagattctgttcgtttgctcactgtcgagtcagccatcgctttcggaactctcctcgataaggctaacaagaagaaactcatcgagccaattctcattgaattgttcgatgacaagtcgtggagagttcgttatatggttgccgagaagcttatcgagattcagaatgtcctcggtgaggatatggataccacacatctcgttaacatgtacacgaaccttctcaaggatccagagggtgaggttagatgtgctgccactcagagacttcaggaattcgctctcaacttgccagaggacaagcgtcagaacattatctgcaactcactgctcaacgttgccaaggaattggttactgatgggaatcagctcgtcaagtcggaactcgccggtgtcatcatgggacttgctccactgattggcaaggaacaaactgtctctgagcttctcccaatctacatgcagttgcttaacgatcaaaccccagaagttcgcctcaatattatttccagtcttgataaggtcaatgaagtgatcggagcagctcaattgtccacatccctcttgccagccatcgttggattggccgaggatggaaaatggagagttcgactcgcaattgttcaattcatgccacttcttgcttcccagttgggacaagaattcttcgatgagaagttgcttccgctttgtttgaactggcttaccgaccatggtaacttgattttttcttaaaaatgtttttaatttaattttttccagtgttctcaatccgcgaggcatcgaccctcatcatgaaggaactgacacagaagtttggaggacaatgggctagcacgaatattgtaccaaaaatgcagaaacttcagaaggacaccaactacctgcagagaatgacatgcttgttctgtttgaatacactcagtgaggcgatgactcaggagcagattctgaaggagattatgccaattgtgaaagatgtagggaaattttacttttttatttaaagaaatcgtaatttttctaatttcagcttgtcgaggatgacgtgccgaatgtcagattcaacgccgcaaagagtttgaagcgaattggaaagaacttgaccccaaggtgacaggaaaatctttttcactatcccaattttctattttcagtacattgacgtccgaggtgaagccactgctcgagaagctcggaaaagattcagactttga