Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-e11   

Cenix:304-e11RNAiCenix:304-e11
PCR_productcenix:304-e11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F31E3.5 Source_evidenceePCR1550WS150 Sequence/Annotation Release
Chunk_score Abs_score1466
Max_abs_score1466F31E3.5
Specificity_index0.859
Rel_score1
Map_statusUnique_ePCRIII69697316971688
R03G5.1 Chunk_score Abs_score329
Specificity_index0.141
Rel_score0.164
Overlaps_transcript F31E3.5.3 Source_evidenceePCR1443WS150 Sequence/Annotation Release
F31E3.5.4 Source_evidenceePCR1424WS150 Sequence/Annotation Release
F31E3.5.1 Source_evidenceePCR1522WS150 Sequence/Annotation Release
F31E3.5.2 Source_evidenceePCR1550WS150 Sequence/Annotation Release
WB_DNA_textTH:304-e111958acgaaagaaacaatgaatctccagatgctatcgaaattttagatcgaaggtgaggagcaagctcaatcgaataccaaatattacttccagatctgagaagcaacactgcaaatggaccacgaagctgaagaacaacgaggacacaatagccaaagtcttgattatttgcctcattatatctatcactttattaatgttaatgctgattttctggagttgagttaacagagatgaacgttgtttatcagttttcaatgtttatttatttcataacccattaaaaagtaaagagttgataatttattcaaaaatcaacaagataaactcaacaatgaagatttacttcttctttggtgcagccttttgggcggacttggtgacctttccagaggatccatcagacttctcaacggacttgataactccgacagcgacggtttgtctcatgtcacgaacggcgaaacgtccgagtggagcgtagtcggtgaaggattcaacacaaagtggcttggttgggatgagctcgacgattccagcatctccagacttgaggaactttgggaagtcctcaaccttcttaccggtacgacggtcaacctgaaaaacaaattggtacataaacgaaacaataagacaaataagttaccttctccttaagctcgttgaacttgcaggcgatgtgagcggtgtggcaatcgagaactggagtgtatccgttggagatctgtcctggatggttcatgatgatgacctgggcgtggaaggtgcgagcctccttggctgggtcttgcttggagtcggagcagacggatccacgacgaatatccttgacggagacgttcttgacgttgaatccaacgttgtctcctgggacggcctctggaagagattcgtgatgcatctcaacggacttgacttcagtggtgacgttttgtggagcgaaggtaacgaccattcctggcttgatgattccggtctcaacacgtccgactggaacagttccgattcctccgatcttgtacacatcctggagtgggagacggagtggtcggtcagttgggcgttgtggtggaatgatggagtcgagagcctcgaggagggtctttccggaagcgtttccttccttgcgctcaacggcccatcccttgaaccatggcatgttggaggagacctcaagcatgttgtctccgttgaatccagagattgggacgaatggaacagcctttggattgtatccgatcttcttgatgaatccagaaacctcgttggtgatctcggtgaaacgggcctcagagaatggtggctcggtggagtccatcttgttgcaggcaacgatgagttgcttgactccaagggtctgggcaagaagagcgtgctcgcgagtttgtccgttcttggagattccggcctcgaattctccagttccgcaagcgacgaccaagacggcgcaatcggcctgggatgttcctgcaattaaagttttataaacgagctaaaaatttaacaaagtcgtaccagtgatcatgttcttgatgaaatcacgatgtcctggggcatcgatgatggtgatgtagtacttggcagtctcgaacttccagagagcgatatcgatggtgataccacgttcacgctcggccttcagcttgtcgaggacccaagcgtacttgaaagatcccttacccatctgaaaaaaatcgggtgagaaaatctttcaaactagttgtttgtactatttacctcctgagcctccttctcgaacttctcgatggttctcttgtcaattcctccgcacttgtagatcaagtgtccagttgtggtggactttccggagtcgacgtgtccgatgacgacgatgttgatatgaaccttttcttttcccatggctgctacggagtgagcaaagtgtttcccaactgaaaaaaaaacaatttaatttaaaagtaagaagagtgcggacg