Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:304-f8   

Cenix:304-f8RNAiCenix:304-f8
PCR_productcenix:304-f8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.13 Source_evidenceePCR786WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.13 Source_evidenceePCR786WS150 Sequence/Annotation Release
Chunk_score Abs_score744
Max_abs_score744C05D11.13
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII64429956443881
Overlaps_transcriptC05D11.13 Source_evidenceePCR786WS150 Sequence/Annotation Release
WB_DNA_textTH:304-f8887aaagcaaaaggtcaaacaacaaactacttatttattaaaaaaattttcaattaatttttatagacccgaaagagttccatcgctcaatgatcccgtgatgactgcaagtgattcttcactttgccctgcttgcttcaaaattcgattttgacgttttcgtgcagcatcttggattttcctagctgatttttgctctgaagtctccgtctgcaaatattgccgtcttcttgctgcatcacgctgtcgccgattttcagcttcctctggtgtttcattcttaatagcatcccgacgtctctgagcattcttggctctacgcaattcagcttcttctggagtttcagccaggagactcttccttctccgttccgcatccttattccttctttcctgagctttttcgaatgactccctttgcagatactggcgtcgatgctctgcagcctttattcttcgattatttgcctgatcttccgactcttgcattctttccattttttttctttcagcttgccttttcaatcgttctctatattcttcttctgtctcttctgagcatctcttccttttatagtctgcagccttggcaagacgtgtgtgagtctcctctgatgtttcacgagctcttctcagacgtttccgatgtgcttctttggagagtctgcattctctagatccttcttgaggttcggatgaacttggaatatccgtaatatgaggtctgaaacttaaaaaaaattttaatatgctatttactactcttactcatcacttgaaccaggtaaaaatgttgctataaaattctgaattgtttcttctaggccagcattttgtggactttcagatttattcccattactcttctcatcttcttcttcgtcttcgac