Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:306-c12   

Cenix:306-c12RNAiCenix:306-c12
PCR_productcenix:306-c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC05D11.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
Overlaps_Gene C05D11.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
Chunk_score (4)
Map_statusUnique_ePCRIII64322736433041
Overlaps_transcriptC05D11.3 Source_evidenceePCR515WS150 Sequence/Annotation Release
WB_DNA_textTH:306-c12769atcttgaggtaattcgtcgtcaacggatggaacaaatgaagaaagctcaaaaagacagaattgagatgttgtctcatgggcacggaaaatacgaggaagttgctgacgagaaggagttcttcgaagctacaaagaaaagcgataaagttgtctgtcttttctacttacctggaaacttccgatgcaaaattgtggataagcatttcgagatcttggctagaaagcatgttggaacacgattcatacatgtcaacgccgagaaggttcatttcctgacaactcgtctcaatattcgtgtcattccaagcatcgctatcgtcgtggtaagtttgaatgtggttcctgctatagtatttttttttctgaagttgtataattcaaatctgactagtttcatagagttttgttggcatctgtaccagattatttagttaaaaaaaaataaatttagaagcaacaaaccgtcgattacattcgtggatttgatgaattgggaggaaaagatgagtttaccaccgagaccatggaaaaccgattggctcgatctgaagtattgactgtcgagaagaagcatacagctcctgcaaaaaagaaaatcattagatcaggagttgaggagtacgataacgaagaggattggtagatgccatcttaagatgattttttcttgttttcatattctcatttgctgataattatgtgcattttgatctcacataatttcccattttttcgctttcctcctcccgtgtttgctgttttatctacc