Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:306-g12   

Cenix:306-g12RNAiCenix:306-g12
PCR_productcenix:306-g12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF31E3.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
Overlaps_Gene F31E3.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
Chunk_score Abs_score430
Max_abs_score430F31E3.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII69723116973050
Overlaps_transcriptF31E3.3 Source_evidenceePCR535WS150 Sequence/Annotation Release
WB_DNA_textTH:306-g12740gctagacgatattgcataccaggatgaagtcgtcacaatgctgaaaggagcgcttcaaggaagagacgtattgcttaaaaaattattcaaactaatcgttttaatttttcagttaccacatcttttgttctatggaccaccaggtactggtaagacgtcagcagctcttgcattttgccgccaactcttcccaaaaaatattttccagtaagtgaaatactgggtgataattttttccaataattatattttcagcgatagggttcttgatttgaatgcatcggacgagcgtggtattgcagttgttcgtcaaaaagtaagattgccactgatttttaattaattaagaattccataattataaaaacgtttcctgtttagattcaatccttctccaagtcatctttgggccacagccatagggaagatgttctcaaattgaaaattatcatacttgatgaagttgatgcgatgacccgagaagcacaagcagcaatgcgcagagttattgaagatttttccaaaactactcgcttcattctcatctgcaactatgtttcccgattgattcctccagttgtgagccgttgtgccaagttccgattcaaatcacttccagccgagattcaagttcaaaggtgaaatttcaaaattaagtgttttttataactttcggtgtttttagattgagaacaatttgtgatgcagaaggaactcccatgagtgatgatgaactgaaa