Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:307-f12   

Cenix:307-f12RNAiCenix:307-f12
PCR_productcenix:307-f12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS ZK637.9a Source_evidenceePCR687WS150 Sequence/Annotation Release
ZK637.9b Source_evidenceePCR732WS150 Sequence/Annotation Release
Overlaps_Gene ZK637.9 Source_evidenceePCR732WS150 Sequence/Annotation Release
Chunk_score Abs_score627
Max_abs_score627ZK637.9
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII89120518913389
Overlaps_transcript ZK637.9a Source_evidenceePCR687WS150 Sequence/Annotation Release
ZK637.9b Source_evidenceePCR732WS150 Sequence/Annotation Release
WB_DNA_textTH:307-f121339aaatgtcaaagaaattgaagccattcgaaattttagaggattcgtgtgcatcagtatgtatttggcttaacggtgaacctacggcaatcagcaatcgcgctgaaaatttatggaataaggccaaatatcgagttgcaactgatggagctgttaatgagattcttaaaaggtgatctaggatccagaaattgaaaattatcgtaaaccgagttttggatttcagaaagagtttcgtcgaatggcctcatattatctgcggagatttcgattcaataaataaacagattgatacaaaaaatgcaaagttagtttaaattctactgaaattaaaaattaatataggcattactcaacttcattgtaatcgtgtttcatgtttgataacatcttctattaatgagcaatgatagaattactgtagggttactgtagtgatcacaaagaattattactgtagcggctgttgaatattagctaaaagaatatataggcgtgaacgttgaaaataaaattaaaatattattgagttgtgtttttaatactggaagactgaaagctacaattcgttgagaagagtgtattgaccaggtcataataatgattttgcactttttttggtatttctggcttgccaactaaatgttattcattctgtgttcaggactaaaaaaataaaaatattttgtcgaaaattgttcttaatgttgttttagagtcgtccatctgcctgatcaagactacacagatctctcgaagagcgttcagtggtgcttagagcagaaaacactaacaagctgggaattcgagaatatcgttgttctaggaggtctcaatggacgatttgatcacaccatgtcaacgttatcatctttaataagattcgttgattctcaaactcctgtgatcgttttggattctagaaatttggttctcgctgttcctacagtaatccttggcaggcctatgtgaacattaagagttaaattcagggggattcaaatcttgatgtcaatcttgaaatgacaacaaaaatgtgtggaatcattccaattgttcaaaaggagacaatcgtcagttcaattggactaaaatatgaaatgggtataatccaatgtttcaacatcatttctattaaacgtttccatttcagaaaaccttgctcttgaatttggaaaacttatcagcacgtcgaatgaagttaccacgagccaagtatttttgaaatcttcgtcgtctctgattttttcaattgaacttgaaaattgggtctacaaacttgattctctatagtatcacattttatggtccctcttaattcacaacttttcattcctttgct