Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:308-a1   

Cenix:308-a1RNAiCenix:308-a1
PCR_productcenix:308-a1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSR08D7.8 Source_evidenceePCR583WS150 Sequence/Annotation Release
Overlaps_Gene R08D7.4 Source_evidenceePCR557WS150 Sequence/Annotation Release
Chunk_score Abs_score515
Specificity_index0.468
Rel_score0.879
Map_statusTop50_percentile_ePCRIII89718478973522
R08D7.8 Source_evidenceePCR675WS150 Sequence/Annotation Release
Chunk_score Abs_score570
Max_abs_score570R08D7.8
Specificity_index0.532
Rel_score1
Map_statusBest_ePCRIII89718478973522
Overlaps_transcript R08D7.4.1 Source_evidenceePCR543WS150 Sequence/Annotation Release
R08D7.8 Source_evidenceePCR675WS150 Sequence/Annotation Release
R08D7.4.2 Source_evidenceePCR557WS150 Sequence/Annotation Release
WB_DNA_textTH:308-a11676gccacaaagtattcgagtcattcagctctatcgacagattttaaaattgggcaagaattggaaagcaaaagaagaaacaaatactgtagttgagagacaacaaattatcactgaagctcgtcaggctttccgagagcaccagcaggtattctcgttctcaatattgatgtggaaactaattatatgggatttttcaggaaaaagacccaatagtgattggcaaactaatctatcaagcggagcagcgaatcgttcaagcagaacactacggaattccacatgcaagacccgaataccttcctcctgataccgcttattcagtcagaacgaaaacgcaaaattttcacaaaatgtcaagaaaacggagaactgagcgggatggtccactcagaaaaggagacaactgaactccagttcaaaagattttattgtagcgcttcaaaaattccggatcagctaatgaaggatattgtagaacaatgcataaaagattcggaatatgctgagaatctttgcaacaatgtcttcaataatgaaattgtcacatcgcatgaaattcgttacaaatttcaaataaatgttcttaaaaacttgatttctgaacttcaagccaataatgttgttgttcctgattcaatgttcgacaggcttggttctctaatgggaatgaaagaaggagaatatgtggaaagagtaagtttttaaacaattcgtcagctcaaatggaaataatttcatattttcaggtttacctaaccgatggaggcgacaaagttctagcgaaattctcggaagctgtaaatcaactatcaatgggtacaactggcttatcagtttggcaagcttcttgtgatctcgccaatctttttcgcttgattccctccgagtacaatcgaatattagaactcgggtcaggatgtggtgttagtggaattgcaattgcaaaaatgaatgattgttgtgtgacgctcactgattatgatgataatgtgctgaatcttttagaagagaatattgcgaaaaacgatctgaagagtgatactgaaggtattttttgagaaataaaatcgactccttccgtatttcaaatttaaaaatatttagaatctaaattgtagattcgtcagccaacaacaatcaagcaacagttcgctcactcaattggtgtgattttgatttctctgaatggaaggaacccacggatttgattatcgcggccggtaggttttgctaatacttttatttgttaaattctttgtttttctatatgatattcgtgtgaaacgaaacccttcaaataacagcttcaggcactcattatccaagtcttctcatttctctgtgtctctcttctctttcacgtctcctttttcagatgttgtctacgacactgcattgctcgcctctctctgcaatgtgctcaatcttctgctccgccactcaaaagctgctatcgttgcgtgcactcgtcgtaacgagtcgagtattgagtgtttcgagcatcatttgagttagttatttttctttcgtacacaatatttttctattcactatattttttacagaaatggcaaaactagaaattgtggaaaaattcgaatacgaaaacggtgcctacacaattggagaaaattcgtatcattatgcatctattttcccatttttctcaactctca