Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:31-a11   

Cenix:31-a11RNAiCenix:31-a11
PCR_productcenix:31-a11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK02F2.4 Source_evidenceePCR853WS150 Sequence/Annotation Release
Overlaps_Gene K02F2.4 (3)
Overlaps_transcriptK02F2.4 Source_evidenceePCR853WS150 Sequence/Annotation Release
WB_DNA_textTH:31-a111677accacatttgaaataccgccaaaagaacatggagtctcgacacgaatgacacgcgctgacggatggtaccgtaccatctcttcactgcgttccaccgcaaagctgaagtttttgtcttttgacaaattttttttgttgtttttttgcgagtttttttgcagataaaagcgaaatttttgttaacttgtcgctatttcactgaatagttcataaattttagaactttgcaccttttatttcaagatattattcggaattatgtttaaaatatcataaatttcccagaaacgtttcaatcttgcaaaattttagctgtttcctttttcgtgtttttggataaaaagttttcgtattcgtattttaaagtattttcaggtttaacctgctgtcgaatagtggaacattttctcaatgcctcatcctaagctcactccaaaatgcgaagcaccccccgaaaaggtgagaacacaaaattatccttaaaattcagatttgtataattctcagagacttgcacatttggagattagattcaaagatcgcagacatatcattcctccattatttcataatggctgggtgggacgaaatgaagatcgaactttactcaacgacacaatcattgaattttatatgtgtgattggatgcgtttggaagtgttcgatgaggctacgtaagatatgaaaaacatttttatgaaattaatgttttcataattacagaagagccagtagtcacgtctttcattcattcttcttaccgaaaataaagacttgttttaaagattttaaggagaatccgccacggagatcagaggtttgtagatatttcaaagattgaaaaacttcaatggcgatttcatcaaatgatatgacatttcagctcgccaaccactataacagattcttccgcagcaaaaatgatgccgaaacgtttctcaaaaaagatattctgctaatcccagttcatctcgacaaaccgaaacattggtaaaatatttttaacctttacaaatctgagaaaactattcgatatttaaaagttctaaatttacttcaagttccatctaattgtttatttttagagtttcaaagagtttgcaggttcctcgtgattgtgcataatccatcaggcgcggttcgtcgaatttccgacgtcaatatacttgacgcgaccaataaagtgaagagtagacgattgtcaagacggataaccggtcatgttaattgtgatgaaaatgccggtgaatgtcgaattattatcatggatagcctggttcattcaaaaaaatacaggtaagcaaatattttaaactgctatgcataaaataaaattcagagaagttattgataagacccatgattccacttttgatcacattcgtctttggctcctgatgtccgcagctgcaactgatgttgatatgttttgcacgagattccggttaattgtatttcttgatatccatcatatacctaataataatttcagaaaagttgtgtgtcagaagcttccgcaacaaaaaaattcagtggattgtggtatctttatgatggcattcgcagagtattttacaaaatacaatactgcgtggcaggtacacaataccaattgttttcagaaaaatgtttattttttacagagcctgccgacagatgctctcgctgatttgaaga