Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:31-e4   

Cenix:31-e4RNAiCenix:31-e4
PCR_productcenix:31-e4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSZC196.2 Source_evidenceePCR648WS150 Sequence/Annotation Release
Overlaps_Gene ZC196.2 Source_evidenceePCR648WS150 Sequence/Annotation Release
Chunk_score Abs_score564
Max_abs_score564ZC196.2
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV87434358744434
Overlaps_transcriptZC196.2 Source_evidenceePCR648WS150 Sequence/Annotation Release
WB_DNA_textTH:31-e41000tcgagcgaagttttgaggatgaatcagtttggaagtgggcggaaatatatggtttcaatatattttgcactactaacagaatactatgtaccacatacaaaatatttcagaaaggatgaaaactgagaaaatacgaaaaaacttattgctcaccctaataaatacaatttgaatctactgcttcagatttgctgaaacctggagaagcgaggcaattatctgtcaagtttcgatcgagcgacaaagttagcctgaacgcaaaatcatacaagctcaaaatagaatcatgtgaatttgaatctgaagatattgatgatttgaaaagtttctggagcagcatccctaatgagaaaatacttgtccataagtcacctattattcttgggactggaagcagcccagattttagaaatgatcaaattgcatcgtgagttttcgtttttcttaattgaaatatcttaagagagatctacttcaacaataattttttttagagaatcttcgagacaatcatctcctattcaaaatgtttctgatgatggcaaaagttcacatcattcaacagccaaacaattacaagaaaataatgaaaattcaaagagcttaaaggttgtgttaatttgttacctaaaaataacaatcatagttttagtatactaaacaactggttgaagtgcctttaggcgaaaatcaacaagctgatcaaactggaaccacctgtgataaaaaagacgagtttcaaaaaaaaaatcaattggaagttgaggttaaaattaaaaaatatattatttttaaaagttctttttataattttttttgcagataaaatttgtggataaaattcatgagatcaagtcccaattagaagacagttttgaattaaaattgaaagaaatggaaatgagactggaggaaaagttcgaaaaaaggatatcaagattaacacaatttatggaaacaataagtttgtcaaatagtcctgggaactctagacgcgttt