Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:310-b8   

Cenix:310-b8RNAiCenix:310-b8
PCR_productcenix:310-b8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSK04G7.11 Source_evidenceePCR339WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.11 Source_evidenceePCR393WS150 Sequence/Annotation Release
Chunk_score Abs_score351
Max_abs_score351K04G7.11
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII71616007162237
Overlaps_transcriptK04G7.11 Source_evidenceePCR393WS150 Sequence/Annotation Release
WB_DNA_textTH:310-b8638agcagcagtcaggcgagtatgttgacgaagagtcatatcttcgtaagaagtaaatccttgatctgggttcttctttctctttcttttttgctcaagcttctcagtaacatctgcagacatctctaaactgcgaacacgttcatagtccaatcccttgtcttctgcagcttttcgatcttgtagctctttaacctgccattgatctctttccttttttgcttcgtggttttttggaagtttgctgcgacgatcttcttcaacgacctacaattttaaattataattgaaaatgtaaacgttaaaacactaacctgttcgtgattctcttttctcgctctttggcggagtttgtgaagatcacggaacctctgattgaaatccttcatttttgatccactggacgacggcccactgctgctcgattgtgattcggaagacatctaggaaaaagtgttgaagagaaatccagaaagttgagaagaaaagctacattgaaacggaatacagaatattttgaacatcagaaaaagaagaaccgatatgatttgaattcatttacaatctatattttttaaaccgatagttacatgttcaaaacatattaatactatccagctttgcgaaacaaagaaggcttt