Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:310-h4   

Cenix:310-h4RNAiCenix:310-h4
PCR_productcenix:310-h4
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS (2)
Overlaps_Gene K04C2.8 (3)
R13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
Chunk_score Abs_score395
Specificity_index0.483
Rel_score0.934
Map_statusBest_ePCRIII68694536871226
Overlaps_transcript R13F6.1 Source_evidenceePCR500WS150 Sequence/Annotation Release
K04C2.8 Source_evidenceePCR465WS150 Sequence/Annotation Release
WB_DNA_textTH:310-h41774aaaatcaaagcctttccacgttcgaacgttccaacaaataaaattatcggaaaatgtctcatttatgatttttttaattttcaattggtttgaaaatgttgtttacttttttccagagaaatgacaactccaagtcctcaggaaatatcaactgtcacattgaactctttgtcgaaggaagaacgaaagaaaggtgagtttctgaacagattaatcattatttattctgtttttagcaattctggccttacaaacaaagaaaaacgaaatcaaattagttattgatgaacatcagaagaaattagctgagtttcgacaatcgattcctgatgggtgctgtgaaatgttcgaaaacgaaaagaaaattcgtctgaaacatagtgtaagcttttttactcaaaaaattgcttctaaataaattcgaattttcagtccacggccgaacttcttccacatttacaaaaagtaggctcgagcagtgtcgacaaagagaaaatgatcaacaacattcggcaaagagttgaagttcaagttgctgaccaggagacttttaagagtatcgaagaacggaatgaactggtagtataataaaaatttgtatttcttaaaataaatatactgatttcagttgcgtcgagaaaacgagaatctcaaaaaagaagtcaataccgtggcagccgaactcctgcaagaatttgaaagttatgaataaacttgtgaacatttattttcgataccacgtgtatttctcattaaacattttcatccacatttttattgtatcaattcatttcttttaactctctaataaagatcatgggattcaaaaaggatgtgcaatttcttggcaatctgccggtttctgaaaaattggtcggtttgtgtgctgagtggatcttcattttttaatcttttcagataatatcctccggaccgataatcgtttatactacacacggctgtaagattaataactttcgtgataaatttgaggtatggtagccacctgggtaatatcaataattcatttaatttagataatgcatgggtggtctccactattgttatcaactgcgaaatgttttactagactcatcatcagtaatatgcaagaaccagtatgtgctccgattatttggaaattgaccgtaaacgtggtaaaataacccaagacaagcctatgagttcaaacacgaaaattatttaatttatagggtgtggatgttcaactattcactcattcttcgacagatccaataatccgattcattgaaaattgcaccgtaaacgacagaaagtgataactctcaacttttctcaaataatttttgaaaattctagaatttcgtctgaagaaattcccgatttttccactgctgcggcgaatattttcttggcggatatgaagagcttctctgagactgttgatttgagaattaacactgatacaacgatcttcaatgagaaaattgatatggtatttgtgctacaaagtttccaatacacaatgttctttcagattgttctgaaacatggtgcatcgattacaatcaatagaattgctcagacatctggtggttccacctcgccacctacattcgattaatttttaagtgttctcccagaaatcaggaaataaagtcttgacgtttaagaccaaaacacgaaaaacctttcatttttgttcgagcaacaagacaactgacgttgtttcgggtcacgagtagagatgggggtcctgactgataatcatcaacaaaatgccgtggatttc