Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:321-a8   

Cenix:321-a8RNAiCenix:321-a8
PCR_productcenix:321-a8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS W06F12.1a Source_evidenceePCR717WS150 Sequence/Annotation Release
W06F12.1c Source_evidenceePCR717WS150 Sequence/Annotation Release
W06F12.1d Source_evidenceePCR717WS150 Sequence/Annotation Release
Overlaps_Gene W06F12.1 Source_evidenceePCR717WS150 Sequence/Annotation Release
Chunk_score Abs_score675
Max_abs_score675W06F12.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1372169313722848
Overlaps_transcript (7)
WB_DNA_textTH:321-a81156tcccacattcaacatggaaatctagattttttaaatctgaaatttctcaaaaatatccaatttttccaatatttccaattttgcaggactaaaatatttgcacactgcaaacatcctgcatcgagacatcaaaccgggaaatctcttagtcaacagcaattgcattttaaaaatttgcgattttggactcgctcgaacctgggaccaacgtgaccggctcaacatgacacacgaggttgtgacccagtactatagagccccggagttgttaatgggcgcgcgaaggtatacgggagccgtggatatttggtccgtcggttgcatatttgccgagctgctacaaaggaaaattctatttcaagccgccggtccgattgagcagctgcaaatgattatcgatttattgggaaccccatcgcaagaggctatgaaatacgcttgtgagggagccaagaaccatgtgctccgcgccggtcttcgagctcctgacacacagaggctgtacaagatcgcatcgcctgatgataagaatcacgaggcggtggatttactgcagaagcttctgcacttcgatccggataagagaattagtgtggaggaggcactgcaacatcgatatttagaagaagggcgtctgcgattccactcgtgtatgtgctcgtgctgctatacgaaaccaaatatgccgtcgaggttgttcgcgcaggatttggatccacgtgtaagttttaaagttttttttaaccaaaaaattataaattttcgatgaaaatcgttctaattttcttaacaaaaaattgatcttcaaaaaaggtaggtaattgataatttcccctcgcgtaattaaataaaaacataaaaattcgaacaaaaattgtaaattttttaataaaaaatttttttttccaaaataaatatttgaaaaagcgaaaattttcgtttttttcgtgagaaatcagaaattcccaatttgtcgaatacctatataagttgcgaattttttagatctcaatttttgccatggaatcaatagattaaaaaaaaaactttttctaatcgctttcaaatttacagcacgagagcccattcgatccaaagtgggagaaggacatgtcccgactatcgatgtttgagctccgcgagaaaatgtaccaat