Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:321-e5   

Cenix:321-e5RNAiCenix:321-e5
PCR_productcenix:321-e5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20G5.1 Source_evidenceePCR1106WS150 Sequence/Annotation Release
Overlaps_Gene T20G5.1 (3)
Overlaps_transcriptT20G5.1 Source_evidenceePCR1106WS150 Sequence/Annotation Release
WB_DNA_textTH:321-e51197ccagccaccattcaaaagttccagcagtgcccgtctactggtccaggaccatctccacttcttcaatatttcggaattcttctcgatcaaggaaagttgaataaatacgaaacactcgagctgtgtcgtccggtcttggcacaaggaagaaaggagttgataacgaagtggctcaatgatcagaagttggagtgttgtgaagaattgggagatctcattaagccgcacgatgtgaatactgctctttcagtctatttgcgtggaaatgtcccgcacaaggttgttcaatcttttgctgaaactggacaattcgacaagatcgtaatgtatgccaagcgtgtcggattccaaccagactatttgttccaacttcgtcaaattctccgtaattcgaatcctgatcatggagcaaaattcgctcaacttcttgtctctgagagcgaaaacggagaaccacttgctgatctttcacaggtaacgaatgagaataaggatttggctaatttaaaccttttcagatcattgactgtttcatggaggttcaagctgttcaaccatgcacttcattccttctcgaagttttgaagggtgataagccggaggaaggacatctgcaaacgagacttcttgaaatgaatctgctcgctgccccagctgttgccgatgctattctagccaacaagatgttctctcactacgatcgtgccgctatcggacaactctgcgaaaaggctggacttcttcaaagagctctcgaacacttcactgacctctacgacattaagcgaactgttgttcacacccatcttctcaagcctgatgtgagtttctaattagatttctaaaataaatgctaatttattttcagtggctcgttggatatttcggaagcctttctgttgaagattcggtcgaatgcttgaaagccatgctcactcagaatatccgacagaacctccaagtcgttgtgcagattgcatccaagtatcatgaacagctcggagctgacaagctgattgagatgttcgaaaatcacaagtcatacgaaggtcttttctacttccttggttcgattgtcaacttcagccaggacccagaagttcacttcaagtacattcaagctgccacgcgcacagggcaaattaaagaggttgagcgtatctgtagagagtcgcaatgttatgatgccgaacgtgt