Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:322-c12   

Cenix:322-c12RNAiCenix:322-c12
PCR_productcenix:322-c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF59A2.6 Source_evidenceePCR1239WS150 Sequence/Annotation Release
Overlaps_Gene F59A2.6 Source_evidenceePCR1239WS150 Sequence/Annotation Release
Chunk_score Abs_score1197
Max_abs_score1197F59A2.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII34174243419084
Overlaps_transcriptF59A2.6 Source_evidenceePCR1239WS150 Sequence/Annotation Release
WB_DNA_textTH:322-c121661gacgtcacacagaaggctgaacggattcagggagaattggaggagagtaagaaggttctggagagcgagaagcaggcttttgaggtaaaaatgacgtgaaaaatcggagatttggcgaaaaattgattccgaccaatcagcgattcgcgatgggcgtggccaacgtcgctgattggttgaaaagacagcaggctgaaaaaggcagaaggccggaaaatcccgaaaaaaaaggaaaaaattccaataaaaacatgtcaaaacgtcaaattttcaccaagaaataccgccggccaatcagcgacgttggccacgcccattgcccatcgctcattggtcggtgctagatgatcgagaatgcagattttgatgaaaaatcgggaaaaaaacttaaaaaattcaaaaatatactgacttacagaacgaaaaagagcaagaacgggaggagcaactcgcaaaagctatggagaaactgaattcggagcaaaatatccttgacgaagttaccaagaagcttgagcaatctgaagaagaagttttggcggctcgcggagcaattcaagagctcacagagaaactggaagagtcggagaaggaaacaagcacagcgaaaacggaactggaagctgtcagtaagaagctcgacagctcagagacgtctctgaaagagttctcggatatgatagaagctatgaagattcagctgattaattgtgaaaaacagaaggatgaagctgtggagctcctcaagcagaagctcgaggaagttgagaagaatatgagtgatgtggaggttcagaagcagcttctactggaatctacaacttcagagatgaagcaacatgcagaagcagctgaaattgtgaaaaaacagttggaagaagctcagagctctattgaaaacttgaagaaggatgcagagaacgagcgaaatctgaaaaccgctttagaatccgacgagagttctgcaatctctgaaatcactaaacaaatggaagcggcgaagaaggagcttgaagctagtgaaaaggagaagtcagagctccgtgagcagatggatcgactccagaaagtgcacaacgctgggcaggaggatattcagaagctgcagaagacgtgggagttagagatggcaaagatcgcgaaaagtacagaagatgagaagttggctcgtgagcagttagctggagagctggaaaatgccaaggaagatctgaaagttgtggaagaggagaaacacactggaattcaaagggctcagggagctctcgatgatgcggagaaagaagttaaagtgctcaaagagcagctggaaagagctcaatctgcactagaatcatcccaagagctggcatcttcccagaaggcagataaaatccaggagctagaaaaagagcttcaaaatgctcagaaaaggtcatcggaagagcttgaaactgcgaacgagatggttagatctttgactgcaacgctggaaaattcgaattcagagacggaaattctcaagcagaagctggaaactttggacaaagagttacaggctcggcagcaaactgaaaaagctttgactgaagaggtatatcctgaaaaaatcgaggaaaataatgaaatatgaccgaaaaattcgactttcacacaaaaatcgccttctaccaatcagcgac