Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:328-g8   

Cenix:328-g8RNAiCenix:328-g8
PCR_productcenix:328-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST20H9.6 Source_evidenceePCR1093WS150 Sequence/Annotation Release
Overlaps_Gene T20H9.6 Source_evidenceePCR1093WS150 Sequence/Annotation Release
Chunk_score Abs_score1072
Max_abs_score1072T20H9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII22470692248277
Overlaps_transcriptT20H9.6 Source_evidenceePCR1093WS150 Sequence/Annotation Release
WB_DNA_textTH:328-g81209tcggaactacgactcctgctcaaatcactgcaatttctgtagataagttgaaggggattgttgatggaatcaataggctccgtgagctgaatgttgatgataagatgaagcagctagaggatcgagtgacactttatagttcatttgttgaaaaaacgaagggaatggagagtgctaacatcttttctaacaaagatgaatatgaggctcaattgaaacaatttcaagaaaaagcacaaacactgaatttgcatcagctggaaagttatttttatacaaatattgatatttttatggcgtccttaaatatattggaggctacagataacgaaaaagaagctgatgaagattttagagaggtgattcgtcttataaaagaattaaaccgttcttacccagactataatccactatttgaatttgaaaaacttaataatcctcaaaatagttttccacttctatatccagtttatgagactattcaagagtattccaaaatcagtgaaacactcgagaccacgatattatctggtattcaaaagaatattgataatgttatcaaaatagccaagtcagctaaattgaatgcagaaagtgttgaacaactttccaatatgttattgtctcgacattccaaatcaactaaagcttccaaacacataactgggtttttcaatggcgattcggatatttggaatattttcgacaacttgaaaacggattggataaataaaacagtgtatggacaagcggaacacattggtaaagctttgcaaacactaaagacagttcaaaccaacgtgcaagattctaatgaatcgattagaagaggcgaaaatgatatgctgaaggaaatcaccgatgtgcattcaaaagtcattcgactagtgaagtatgctgaaaccgtggagccgtttattggaagcatcgaagcaattgatatacctcaagtgaacaaagatgtgaagatctctgagatggacataatggaatctttgctacacaacatgacattgctgtcgtccaaaatatcaacgctgaaagaattgtataaactgatgaatactttgaaaatcgaggaaaaccagaaaaagttagctgaaatggtcagaattgctagtgttactggagacaagctcaagttgtaccgaggaagtcaagaattcaaggatattcactaattgcttctaccaatgcatgacgcgtata