Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:33-f5   

Cenix:33-f5RNAiCenix:33-f5
PCR_productcenix:33-f5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST18H9.6 Source_evidenceePCR930WS150 Sequence/Annotation Release
Overlaps_Gene T18H9.6 Source_evidenceePCR930WS150 Sequence/Annotation Release
Chunk_score Abs_score846
Max_abs_score846T18H9.6
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV92131729214858
Overlaps_transcriptT18H9.6 Source_evidenceePCR930WS150 Sequence/Annotation Release
WB_DNA_textTH:33-f51687ctttggccgattttgtgaattctctgtagactttccgtttcgaatgtagaatttgttcttgattgtataaatcttcatcttcgcctccaataatcatatcttcgagaattccatatttgagtacaataacagctttcatacacggaacgaattctttttcactatttgggcgccgagcacagtagtgaacctgaattaaagccattttacattgggaaacgggagttggtttcgggaataaagatttttgaaaaaggtttatatttttctaaattagactggaagaaaaactcacttcaatgagactttttgaattcctaaaacatggatgactgattcttttgaatctccatgtcaaatcacccctcgttttattcataacagcatccattgctaagaaaactcctttattcgcatcttcaacgtgtttcgagaatttcaaaggtggtgggacagataatcttgagactctcggagcatgaacagcgttttgacgaaatgtttctgacacagcgataatgtttttctgaaattagaatgtaacgaattcagagtatttccaaatattacctcaataactgtcctctcgtccattgcctcttgtaatttgtagaataattgataagcactttcatctttctgtctgagatcctgaaattaaatatttaaagttccaagttggcaaacggtttttttaaataatttattctcatttaaaatgatgtcttcgcagaaagagttaaaaatgaaagaaaacagtctccgtatagtgaatatatttgttaaacaaattatagaatttttctaaattgttgtagaatttgaaacatcgtttgtcacattttcagggacttttccacaataaacgttaaattatctatctttataccaaaattagagattcaacaaatttcttgttttctcaagttttccttactgtaaaatgtctgaaaatttgacaaaaatgtttcaaatcacatctttaaaaaaaacgaataaaaaactaatcaatatatccggaaaatgcaaaaaaatctgctttaagttattccgctgaattctaaaattcatcagcttatttcaattttttcgttgaaaaaaaattagaacttaacaatgttatattactacattgagactgtttttttttccgtcacttgtgttaggacaaaaaaaaaagcttaaaaaactataaattatgacttttgaactaagaatcttaatcattaatcattaaactaaattaatcaaaaactcacttgtattgatgattcaacagctttatatagaggccttttgtcaaatacagcattatatcgacatttgagtgctgctgctctattcaattcataatacatatttcccatttctgataatgcttctcttgctcttgataaatcttccattgtcgaatgctctttcatcgattcgtctaatgcttttttcgacttttgacgcattttctccaatttactcttcatcacttctgcccattgatttaacgcaattacgtgcttctccgttgtatttgatggaagtgttaaaatcggtcgtccagctgccggattccctgcagttgaaggtcggttagcagtgtttccagattgaagaacaggcatcgattgagagtgaggaatattacccgaagagatacgtgctcccgatggtcctgaagcatttgcagatg