Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:330-f1   

Cenix:330-f1RNAiCenix:330-f1
PCR_productcenix:330-f1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDST26A5.8 Source_evidenceePCR414WS150 Sequence/Annotation Release
Overlaps_Gene T26A5.8 Source_evidenceePCR454WS150 Sequence/Annotation Release
Chunk_score Abs_score391
Max_abs_score391T26A5.8
Specificity_index0.748
Rel_score1
Map_statusBest_ePCRIII64622346462974
T26A5.9 Source_evidenceePCR133WS150 Sequence/Annotation Release
Chunk_score Abs_score132
Specificity_index0.252
Rel_score0.338
Map_statusBottom50_percentile_ePCRIII64622346462974
Overlaps_transcript T26A5.9.2 Source_evidenceePCR133WS150 Sequence/Annotation Release
T26A5.8 Source_evidenceePCR454WS150 Sequence/Annotation Release
T26A5.9.1 Source_evidenceePCR131WS150 Sequence/Annotation Release
WB_DNA_textTH:330-f1741gaaggatcgttttgagcaggaatgagttggttatgagtgatcagttcatcaatgaatctgcaatattataaattattcagataaacttcagatttaaagaatagaactaaccatcgacaggagtatcgtcaataatgtcgtcatccatttcagcattgacagagctggattcaactggatttttacgagcgagagccttctgctgactaataactttccatttatcgttggcggacttgcactggaaattttaatttcttaactctttcgaaacccataattacatgattgtgaatagaagtattctcaagctctcggagtcctttgacaacatcatctcctgagatcgtcttgtgcttctgatcgcgagcagattgagccgaaacgtcggacaagtttatgagaaacactgctgcagcacgagcgatgacgtctcgagcatcttttgatgcagaaatattgtcttctttcatgagccgagtcacaattgctgctggcatcatcatttgagcaattcgatcatcgttttgatccacatcgtttgatgacatttctatcttaaattattgccttgttcagtttcgagtataaaaatgaagcacagataattaagggatttaaagctatccttttatttttacttttagtgcgagcacttttcgagaacaaaaatattatgagttctcttttctctcaaaaacggacaacgtaagaagatttatgggtgatggaggaagattc