Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:331-g1   

Cenix:331-g1RNAiCenix:331-g1
PCR_productcenix:331-g1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene F56D2.1 Source_evidenceePCR1450WS150 Sequence/Annotation Release
Chunk_score Abs_score1240
Max_abs_score1240F56D2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII55920805594093
Overlaps_transcript F56D2.1.1 Source_evidenceePCR1450WS150 Sequence/Annotation Release
F56D2.1.2 Source_evidenceePCR1439WS150 Sequence/Annotation Release
WB_DNA_textTH:331-g12014attttcagagaacaggggaaaacttgagagaatggctctcagactcgccgtcagctctgctttgcgtccggctctcaatagccaggtaattttcttgtgagattgctaaaagagaaataaaaactcttaattgaaaataaaattgaaagttgtatgcccacaggtcgcatggagaacgtaacaacgatgataatgtagaaaatctaattaaattaattaattttcaggttcgcaatgcttcatcagctgtctccgtgaaggacgtgcttgccagcgctccacaagctgaagttaccaccttgaagaatggcttccgtgttgtcaccgaagataatggatccgccaccgctaccgtaattttgcccactagttttctaaaatttcttttgttttaaattgtaggtgggagtctggatcgagaccggatctcgttttgagaacgagaagaacaacggtgtcgcacatttcctcgagcgattgatccacaagggaactggaaagagagcatctgctgctctcgaatccgagcttaatgctatcggagcaaaactcaactcgttcactgagcgtgaccaaaccgcagtttttgtccaagctggagctcaagatgttgagaaaggtaaatatttgtaacttataaaattgtgttaattttccaaaattttcagttgtcgatatcctcgccgatgttctccgcaacagcaagcttgaggcctcaaccatcgataccgaaagagttaatcttctcaaagagctcgaagcttccgatgactatcatcagcttgtcctcttcgatatgctccacgctgccggattccaaggcaccccactcgctctcagcgttctcggaaccagtgagagcattccagtaagtatttatttgggtttacataaagttgattattttttcagaatatctctgctcaacaattgaaggagtggcaagaggatcattacagaccagtgcgcatggttctgtccgctgtcggaggaggagtttccaatgtttcaagcctcgccgataaatatttcggagacttgagcaacgaatacccacgaaaggttccacaggtcgatggaacacgattcaccggatctgaatacagataccgcaacgataatgtcccacacatgtatgctgctttcgctgttgaggtacaaataataaatgtgtgttcagtctttcattttacttcatttttagggtgttggatatgcccacaaagatgctctcgctcttcaaattgccaatcaattcattggtaagttggcttttgtgtgaatttttcaattcaaaccgtaattttgatgagttttaggccaatgggatgtgacccacgctacatccagaacagctgcttccagacttgtccaaaaaatcggacacgaccacggagtccataacctccagcatttcaacatcaactacaagtaagtatctttttttgcaagcttatttaaatttttattttctttttttcagagacactggattgttcggaatctactttgttgctgatgctcacgacttgaacgacaccagcggaatcatgaagtctgttgctcacgaatggaagcatttggcctctgctgccacagaagaagaagtcgccatggccaagaaccaattcagaaccaacttgtaccagaacctcgagaccaacacacaaaaggctggatttaacgctaaggaggtttgttactctgcagaaaatgctatggatagttatttcattattttcagcttctttacaccggaaatctcagacagttgtcagaacttgaagctcaaattcaaaaggttgacgctggagctgtccgcgaggctatttcaagacatgtgtacgatcgtgatcttgctgctgtcggagttggtgagtagttttccacttgctgttgtttttacattatgagaattgcaaacaatttctcttttctaggtcgcacagaagccttccccaactacgcccttactcgcgctggtatgtcgtggtggagaatgtaagcagtgaac