Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:332-e6   

Cenix:332-e6RNAiCenix:332-e6
PCR_productcenix:332-e6
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.17a Source_evidenceePCR15WS150 Sequence/Annotation Release
Overlaps_GeneY47D3A.17 Source_evidenceePCR15WS150 Sequence/Annotation Release
Overlaps_transcript Y47D3A.17b.2 Source_evidenceePCR15WS150 Sequence/Annotation Release
Y47D3A.17a Source_evidenceePCR15WS150 Sequence/Annotation Release
Y47D3A.17b.1 Source_evidenceePCR15WS150 Sequence/Annotation Release
WB_DNA_textTH:332-e61215ccatccgttgaaaaatggacgatctaattagacaaaaaagaagacgattgtaaaattaagtgaaagttaatgggccgtaaatagttaaagaaaataaattttctacagcgaaaaaaaaatcaaattcaaaagagattacaaaaagtagaattcttcttgatcatatggaatacgaaaaaccagttttactgtgagtgtgtgtgtggacattgccagcactagccaagtaaaagttctttgtatttaaagaagatattacattggttagtaggagaagaggaatagagaaataagaactggcctgtcaaattgtgtaattttaaaaaaatatggaaaagttttaactttctacatgaaatagtgatatacataggaaatatagtaagtaatgaccatactgttactaaaattgccaaaaaaaaaactagaattagaaatttgtattcaatgtcgaacacgtggtgtcaaagtgtctcatttcggtttgatctacgttgatctacaaaatatgcgggagaagagacgcagagttctcaactaatttcgcatggttaagaacgtgctgacgtcaaaaattttttttgggaaaaaaattccagcatttttgtagatcaaagcaccacgtggtcaaatagttttgaaattgcaaaaaaaattacaaaaattgccaaagttaaaaaaaaactgccaaaaagttactgacattgtcaaagagttcaaaaattgccaaaaattattttttaaaaattcaaaaaaatttaaaaatagctgaaaagttactaaaaatctaattttttcacaatgactttcccattcgaaatgcaattttttttgaaattttaccaattttaaatttacggaattgtcgaaattttttgaaattttagaaatttttttttgaaaatctatattatgagttgatttataaaattccacctaaaatcacaaatttgataataatttaaaaaaaactttaaaaacaatattgccaactacgttgccaacattttttttgtttgaacgcagtgagaaaatgagaaaacgagagagagagattgatataacggaggctcgtagagtggtcagaaatagagaaaactgcagaaaacaacaagaagaacggcggagaacaaaatgaagaaagcaaaatcgttgtttttctcccatatgggaaagagatggcagaatgcgataacttacgccagatcctcttcg