Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:333-e10   

Cenix:333-e10RNAiCenix:333-e10
PCR_productcenix:333-e10
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS K04G7.10 Source_evidenceePCR298WS150 Sequence/Annotation Release
K04G7.11 Source_evidenceePCR33WS150 Sequence/Annotation Release
Overlaps_Gene K04G7.10 Source_evidenceePCR426WS150 Sequence/Annotation Release
Chunk_score Abs_score384
Max_abs_score384K04G7.10
Specificity_index0.691
Rel_score1
Map_statusBest_ePCRIII71607337161272
K04G7.11 Source_evidenceePCR193WS150 Sequence/Annotation Release
Chunk_score Abs_score172
Specificity_index0.309
Rel_score0.448
Map_statusBottom50_percentile_ePCRIII71607337161272
Overlaps_transcript K04G7.10 Source_evidenceePCR426WS150 Sequence/Annotation Release
K04G7.11 Source_evidenceePCR193WS150 Sequence/Annotation Release
WB_DNA_textTH:333-e10540ccgaagctcttggattctcagctggattccacgtggcgattccttgttctactttatatgctaacaattcatctttttgtcgtcttttttcttcttttgcttcagcttttgttactactgggatttttgctggagtatctttcggatcctgaaaaaaaaatagcttccaaaataataaagttacgttcaaacctcaaataattgaatatattgagcaactccagtcatcggagcccttttagcatttttgtccactagtaggtcctggcatggtggaagatattgcactggtggtcgtgcttcgaaaagcgccagaagattgggaggtagaaatgccgtcatgtcacctgaaaataatttttatttattatttgagttttgtaggtacaaagattatcgaatagaagagagaaaatagtatggaatgggaagatgaagaacaaaacaaaagaagaaaaaaagttgaaaaaatgtctgaaaaagaaaataaaaaagcgatcctcggtttcagatagctgttccacgttccaaatcgtcttt