Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:334-h8   

Cenix:334-h8RNAiCenix:334-h8
PCR_productcenix:334-h8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY49E10.22 Source_evidenceePCR702WS150 Sequence/Annotation Release
Overlaps_Gene Y49E10.22 (3)
Overlaps_transcriptY49E10.22 Source_evidenceePCR702WS150 Sequence/Annotation Release
WB_DNA_textTH:334-h82024gagcttctcgaatccacgtcatttgacgatttccgtatgatgcgaacgcgctccagtgataaaaatgcgcgccaaactcgaaaatcgttcgagtgtcacgtggaatcgtgcatttccgaatctacatcgaaaatttacgtcatagaagacattttctatctgaaaagtatgcggcacccgtttcaaaaaatcgccaaaaggcatggcttgcagtttggaataatttttctgaaagttggaatagtcgaagcgctgagaagaaattcgcatcgaactggaatcgagaagcagaaaaatgaaacaattcggaaaatttttgaaaaaatggaggatcctgatgaaattctcgaaaattcgattgttctggagacggatgaggtggaaattgacgtggaagttgtgatgaataagctgaaattcgattttactgccaaaaaaccaatagttccagaagtttcactaaaaaaatcgcatattcaggtaaacacggacaaacacatttagttttacaagccgcgacgcgacacgcaacgcgccgtaaatctaccccagatatggccgagccaaaatggcctagttcggcaaactcttccatttcaatttatgagggaagccagaaatccgtggacgtattatcgcggaaaattccgaaatcgagatgcaatcgcgctccacggacaaaagtctcgttaggtggcaaaaccagatattcgaaggtttttaaaatataatttttgtgatttttcacattttcaaaaaatcattccgacaaacgaataaaacaaaaaaaaataaaattttcgaatttacggttttccgccaatacctaacgagacccaaaatttgtagcgtcttcatctgacgttggagcgcgattgcacttcgaaacatttttctgcgtccccataataatattgtaactattcggcacgtcactttaaaggaacacatcatttcttccgttggtctcaccacgataacagtgggaacactaaattctgagaatgcgtatttcacaacatatttgacgcgcaaaatatgaaatatctcgtagcgaaaactacagtaatcctttaaatggctactgtagcgattgtgtcggtttacgggaattatttatttatcgatataatattaaagtttagctaaaaacgagaaaaaaacccgtaaatcgacacaagcgctacagtagtcatataacaacttactgtagttttcttttcgctacgagatatttcatattttgcgcgtcaaatatgttgtgcaatacgcattctctaaatttagtgttcccctaatagcaagagctcctatttttagcgtcttattgtaccaaataaatcagtgatatatttccagaaacctccaccaccatcaaaactcgaatctctggatgttctaacccgtcgattggtgtctgaactaatgcaaaatgataaaacaatgaatggtcgaaaactcagtgatgctaggaagaagcttctgatagatttatctggaaatttggaaatttcaaatgaaaacgatcccaaattcttatatgatctcaaattgaaattaattgaattttatgataaataaatattatatagatttttatctttgttttaattgtctgaaaatgcgacattcgaaattgaaattgcaattgcgctccaatgccaaatgaactgtgaccttatatattgggtctcgttaggtatactcatttttcatggattttgctatttttctgttgattttaatgatttttatgtcgaaaaatatttctaaaaaatttgaatttccggttttgccgccaaaatacctaacgagacccaaattattggggtgcgctcgcactttggaaaaaaatcaagtttttttgcatctataatattatacgaacacaaaattctgagattgcgtattgcacaacacatttgacgcgcaaaatatctcgtagcgaaaactatgactactgtagcgcgtgtgtctatttacggactcgattttcgaaataaaatcgagcaccaccgtaaatc