Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:337-d1   

Cenix:337-d1RNAiCenix:337-d1
PCR_productcenix:337-d1
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY71H2B.5 Source_evidenceePCR78WS150 Sequence/Annotation Release
Overlaps_Gene Y71H2B.4 Source_evidenceePCR4WS150 Sequence/Annotation Release
Y71H2B.5 Source_evidenceePCR215WS150 Sequence/Annotation Release
Chunk_score Abs_score185
Max_abs_score185Y71H2B.5
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII26183392618955
Overlaps_transcript (2)
WB_DNA_textTH:337-d1617ctgcttttggtgggtgatttatgggttttcaagctctagtaacgcgggatgtcccttgaaatggcagagttttgggaagctcggccgcgacgcagcagcgcgcggagcggctcaggcaaaaacgttgattctgtttttttttctaccagaaaatgataaaatcaatgtgttcgtctgagccgctccgcatgcagctgcgtcgcggccgagcttcccaagctgaaaactcttccatttaaatataagagggactctgagcccccttgagctctttttttcaaatctaataaatgttttccaggttgattcggcgcacaccagcgtgatgcggagccaggcggtgcataatattgtgaaggaaatgtcatagggaatttttcctataaaaattaaaattttcctattaaaaaaaatatttaaatatttttcttgttgttaaatgttaatcgtaattcgtccttgagcgtttgaatgtttttttgatgttttggtttgttgaataaaaactttcaaaaataaaaccgacaactgacacattgatgaaaaagtgagtaaaaagttagtcagctgttccatcggaagccggctcaaagctctcaagctccaaagctccaaag