Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:337-g8   

Cenix:337-g8RNAiCenix:337-g8
PCR_productcenix:337-g8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS Y71D11A.3a Source_evidenceePCR68WS150 Sequence/Annotation Release
Y71D11A.3b Source_evidenceePCR68WS150 Sequence/Annotation Release
Overlaps_Gene (9)
Overlaps_transcript Y71D11A.3b Source_evidenceePCR68WS150 Sequence/Annotation Release
Y71D11A.3a Source_evidenceePCR68WS150 Sequence/Annotation Release
WB_DNA_textTH:337-g81500aaaaattcccagatcggcttgtgccgcttggcaccctgccaatgaatgatgtgcagagagctgtagaagtaagtagtagatttttgataatttattgatttttagagcagaaaaaagttttgaaacatttcgaaaaaaaaatgtttttttgggtaatttttcaaaaatgaagtttcatcaattatatcaggttgtcccataagtttttgtactattttttttttgaaaaaaatttatttctctcaagcgacaagtagtactattcacacaagtattcaccattagaccacttgttgccatttactaggtaacatcatgatgccacgggagaagaaatccggcgaacgcgatgagaagaaagtggagagttcagttttgagatgctcttcgtcgtcgaattgcttgtcgcgcatgtagtcactgagagacaagaacaaatggtagtcggttggtgcaagatctggagaatatggtggatgcggtaaaacagtccaaccaagatcttgcagcttttggaaagtcttcttggcgacatgaggcctagcattatcgtgaagaaaatatagtttttcatattttccgttggtcttttctgcaactcggtccaattgggcacaatagtaatcagcagtgatagttttattagttggcaacaattcccagtgcacgggtccttgaacgccccaccagacacagatcataatcttttttgggtgaagatcaggctttggcgtcggtattcctttctcaccgatcggaagccattgacgttttctggaatggttaacatagagcacccacttctcatctccagtaaccagattgttcagccaatcgaactttcgacgaaaagttagaagttgagtacaaacgttgacccgagtgagcttctgtgatgccgaaagttcatgaggcacccaagttccaagttttgaagtaaaaccaaggcgacccaagtgacgtgcaattgtgctatgacaacactcaagcttctcttccatttcacgaagactaagacgaggctcttcctccaccagcttcactaggtcttcttcatttaactctaccggtcgcccagaacgttctatttcttcgagactgaagtcgccgttcttgaacttttgaaaccaactctttgctgtattataagagagtgctccctcacctatcgcaccgcatatgtttcgttccgcttccattgctgaatgaccaagacgaaattcataaagaagaagcaatctaacgtctcgacgttcaagtttgatgattgtcatcgtggcaaagtagaaatggatgaaatgaatcttttctgaaaggggacgacccgaccttgacacgacctacgatgaaaaaattttaaaactttctagaagttttggaaaaatatttgaaaaaaagtacaaaaacttatgggacaacctgataacttcaatttttagttctcctcatttttagctttgaaacaacacccatcatgcctaggttcgggcgatttagaat