Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:338-g2   

Cenix:338-g2RNAiCenix:338-g2
PCR_productcenix:338-g2
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSY47D3A.1 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Overlaps_Gene Y47D3A.1 Source_evidenceePCR1035WS150 Sequence/Annotation Release
Chunk_score Abs_score930
Max_abs_score930Y47D3A.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII1113932111141004
Overlaps_transcriptY47D3A.1 Source_evidenceePCR1035WS150 Sequence/Annotation Release
WB_DNA_textTH:338-g21684acgaaaacgtaattgctggggatataactttagagaaatatgtgaattagggtgatcatcgttttgagccatcaaaataactcctgaaatgaagtcctcaacgttgtcaggattcatgagcactttgcaaacttccttcgagagtttcaaagtgatcttgttggatgggaatatcgtgcgaacatttggaacaaaattgttaaatagtgatccatgacacttttccattattcttgtgagttttatattaatttccactacatccaatgtgtacattgaacgttgttgagtccggtaatccacatagaatttagcttttggatcaatataatcagtattctgatagaaatcgtcgttcgtcacatttttgaacccaatttcaacagtttttacattccattttgttattaacatatccacaagctctctcggtagagaatgtcccaattccttcttttcgaatatagatgttagaaaaattgtaaattttgagcaagtgatgatcgagttgataaagttttcaactagcttcggatccttctgcttgttaagccataataatacgtagagatctctgaaatgattaattgtgtaatgggctcgtttaagtggtgtcaggctgtcccataacggtttgatctacaaaaaatggtggcattttttcccaaaccatgtaaagtgggttaggaattttgcaactaaattctcgcgattttcgtggacactctaacaccacgcgtttgtttcgaacgttggctgataaaaattttaagagtttttccgtaattaccgtaaagtatgtagtaattgaaaatcgatcatgcataattttctcagcgtcggaattttcaaacggtttagtactttgtaagtgggtagtattacatatgcacgtggtgtcaaactgcccaattctggtgtgatcaacaaaaaatgcgggaattttttgcagaaaaaaatgtgacgtcagcacgctgttaaccatacgaaatctgttgagaagtctgcgcctcttctcccgcatttttggtagatcacaccgaaattgggcactttaacatcacgtgcctatgtatataagtttatacggttctcaaaaattttagaaaaattctaaaactcactcgtctgtgatctgtaatgcatcaaagcttcgtttttgccccattacactttgaaatatgtccagttgaattggcccgtatactttacagttttgaatcatttttctacattcgccacatcctgcaatgcagatattatcaactccaataaattcttcgactctctcatctgaaagtaagaatattagaaaattaagaatggatcaatagaactcacaatctgaatctgtaaataagtcattgagagccaaatgaataatttctctatcaatacaactgaattccaagtcttcaattattattttgaataccgttatcttcatcgtttgtttcaagaacctgtaatataaatttacatactcattttcataacaaaacttgcctcgcatactttcgtatgttcttaacattaagctctaccgaattcaagttcactgtacaatttgggcatcttctaataatatcacaacgagtaggcttgtgaaagatcactgtttgatgctctattcgaatcgaatgaatgattccaaaattgaatgctttgttgaccagctgcaaag