Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:34-c12   

Cenix:34-c12RNAiCenix:34-c12
PCR_productcenix:34-c12
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF26F2.1 Source_evidenceePCR825WS150 Sequence/Annotation Release
Overlaps_Gene F26F2.1 Source_evidenceePCR825WS150 Sequence/Annotation Release
Chunk_score Abs_score676
Max_abs_score676F26F2.1
Specificity_index1
Rel_score1
Map_statusUnique_ePCRV2055692120558375
Overlaps_transcriptF26F2.1 Source_evidenceePCR825WS150 Sequence/Annotation Release
WB_DNA_textTH:34-c121455aaattcattcgtttcagccgacacttccaaaattgctcaaaccgttagttcttctttaaaaatatgtttgtcgtaaactatagttaaaattccatcacaaaattgacgatacccaaaaatataagatgaccgattattggttcattaaaaggttcatttaaaaagacatcatgaaaaattagggtatttgtaaatgatgtaaaactaaaatgagaaaaaaattcgtaaacgttcctctgaatgtcgtgctcatggatgtatggtctaaacaaagctcattcataaaaattttaatcaaaaaaataaaaaacgtttcttgattttctcttccttcgctattgattttgcgtctcttttggcatgatcagcctctaatatcattcgattgttttccatcattctctgagtattcacaatgatcaattaaaaaatttcattagactcactttcatttgattaaatccgtctatatttctgatttcctgttgttccaacgacaatcgtaagtgattagggtctttatcttctggtccattgtaggaatgagtctaaaaattgagtggtgtgtgtgttaaagtataaaaccttaattcctacttttctattgtcgacgaaatgatcatcaaattgctgattatgaatctggctattgttggtttgacggcgctgaagatgaagttcatcagcccttgaagtattgtgagaatttccgcgatatggcccatttcctctattgccaactctcgtttggtgatcttcgcggtgtctctgacctggttccatgtacatcttaaaatttaagttataggtgtattcatcggatagttcttaccctctgctgatcatccgaccaatcttctcgattctctgcataccgttgcactccttgatcaaacacccctctgggattctgaaaatttaggttttgcattttctcctacctcgaatggggtattctctagatttaatatttattatcatagaaagctgacactttattttataaagctatatgtgaatcaaaatgcgttttaccccattttcctcatagtaagctttgcttattgcatgtcttagtcgaactgactctgacgagtatctcttttaccagcattataaacttgtttcgatcttaccatggagacatttttgtaattcggctcaaggcttgttcgatcattttcgtgaaatccgtgacctctcggctcttcatgagtttctagttccctgggctcaacgaatccgtggacgttttgataacttgatgcgcccatccgttcttgtgccactctgggatttgcaaaattttgctctcgctttttctcaaatctcatttgttcgttttctcttgatgctcgattctgttcgatgtgacgctggaattataatgtattcacagtaaaataaaaaatttgttacctcgtctccccttagtctccgctcttcttgctgact