Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:34-c5   

Cenix:34-c5RNAiCenix:34-c5
PCR_productcenix:34-c5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDS R11A5.4a Source_evidenceePCR141WS150 Sequence/Annotation Release
R11A5.4b Source_evidenceePCR141WS150 Sequence/Annotation Release
R11A5.6 Source_evidenceePCR342WS150 Sequence/Annotation Release
Overlaps_Gene R11A5.4 Source_evidenceePCR176WS150 Sequence/Annotation Release
Chunk_score Abs_score85
Specificity_index0.234
Rel_score0.305
Map_statusTop50_percentile_ePCRI78663617868047
R11A5.6 Source_evidenceePCR342WS150 Sequence/Annotation Release
Chunk_score Abs_score279
Max_abs_score279R11A5.6
Specificity_index0.766
Rel_score1
Map_statusBest_ePCRI78663617868047
Overlaps_transcript (10)
WB_DNA_textTH:34-c51687accaaagtttcggcacagtcggtgtagagaatcatgtctgttgatccaaaccttcttactccttacaaggtaatattttttatttatgttcttgcctaatatatgtattgttttagaataccggagctgccaacgcatctctccgtcagatctctgaagatgctttctacgttgtcaatgaggtcgtcatgaagcgtcttggacatgttccgattctcaaggtaatttttgaaagttccgaaaagaaagcaattgaaagtgtttacacttttaaattgttataatggcaacgagtataacacttgaacaaacaaaatgataaaattgggtggaaagtacagaaaatcattaaaatttatttcgatacatgtacacaaatgtgttgattctagaaattgtgatgaattggattttgatcaaaaaccatgtgagatggtatcgaaaaagaaaattgaaataagaaatcactgaaaagattatgttctaaacttttaatatcgtttcttgattttccaaaaaactttcaataattgtttcgttctgaaaattgcttctgatttcattccaccaggcaacaatacaaaagggacgaacaaaaaccaaatatttgctaataagattttattccattgcttttcttttcttctttccaatattttcttcttcacaataaacaaactattgtgtgtagtggtagagaccgaagacggtctgcgttttagaggccaaaagagcgatcttgaaaccaattacaaagcaataagaaggaggaggaggaggaggtgatctcttatcacttatcactgattgactcgctgatatcatatcacaccacgaggacagagacggggttttccaaacggcgattctcgaacagcgcaaagtacgcacttagatcttctacgactaggaaccatagaatattccagaaaagattcaagaaacgagagcgcacaaaaatgtgagggagggattggcacgcgccttgctttttcaaatggaaagtggctttttcaagcaggaaagggtcctcttgtacagcatccgagagggttgtttgttgagagtagccaacgaaaaactaaaaatttgtctcaagggaaaaatatttatttgggaataattttatatgctgtcgtatctacataagtttactatagttttggaaaaaattcactatcaagcaatttcagcatataatatttttttttaaataatggaaacaagtagttctttccgttctttcaaaaatttcaaagatagtaaattttgtcgaaatttaaagttcaaagtctcaggctcttgtggcttatgagctcccttcttttttcgaaacttcttgatatctacacgtggttgtttgcaaccttctccatcttctcctccccgtgtctgcgtgcaattcggcacaagtgccggggagtcggctggagcagttggtgtccctgtccctgacaactcggcccgtaactgcctctggtcaatcgatctaggagtgcctgtgagagaacgagatgaaaaaaaaactaaaaataaccaagagaaatacataaacaaatttttttcccagcatgaaagattctcgtgcagaggaaccagtttcggatagcattgaaatggaaaggtcaatgttcaaatgatacgatagacggttgttggtgtagggcagaaactgcaaggaccggta