Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-d11   

Cenix:340-d11RNAiCenix:340-d11
PCR_productcenix:340-d11
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSF54C4.3 Source_evidenceePCR475WS150 Sequence/Annotation Release
Overlaps_Gene F54C4.3 Source_evidenceePCR475WS150 Sequence/Annotation Release
Chunk_score Abs_score412
Max_abs_score412F54C4.3
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII8578186363
Overlaps_transcriptF54C4.3 Source_evidenceePCR475WS150 Sequence/Annotation Release
WB_DNA_textTH:340-d11583ggactatcgtcattttcctcgtcttcctcatgatcaataaccacttcttggccgacaatcatggaatttccgtctaaattcatgtccgagccgcccatcagctgataattggctccacggcgaacataatccccaagggaagtctcttcgtcaataattccgagtccgtgaaggcgagaagcttctttatcggttcctggaagcaaaaaatcgttttttcacagattttttaaaagatttattacttattgccgaatcatccacacattccactatcgttttcggacgttttcgaccgccgagaagctgttttgtggtgactcgttgcagtggaaccggagaatcttcgtattttttcggtcggccctggaaaaaattaaattttttttcgtttttcaatcagaatcttgaaatatccgccttacccttggttttttatcatcttcctgaccttctggccgtggatgtctgtgtcttttgtgtgcactgagacttcgatcggatttcccgacgtattcgcataaattgcactgaaaatcgatatttgtcggcacattcaccacgtccacatcgtcctgctcat