Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-d5   

Cenix:340-d5RNAiCenix:340-d5
PCR_productcenix:340-d5
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_Gene K01G5.7 (3)
Overlaps_transcript K01G5.7.1 Source_evidenceePCR207WS150 Sequence/Annotation Release
K01G5.7.2 Source_evidenceePCR207WS150 Sequence/Annotation Release
WB_DNA_textTH:340-d5207gggaatggaaccatgttgacagccaacttgcgaagatcagcgttcagctgtccagggaagcggaggcaggtagtcactccagacattgtgagagacacgagatggttcaggtctccgtatgttgggttggtgagctttagagttctgtagcagatatcgtagagagcctcgttatcgatacagtaagtctcgtcggtgttctcaaca