Go to RNAiDB Home Adult Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie Wild-type C. elegans Movie
 

RNAi_reagent: Cenix:340-d8   

Cenix:340-d8RNAiCenix:340-d8
PCR_productcenix:340-d8
Sequence_typeGenomic_sequence
Reagent_typePCR_reagent
Overlaps_CDSC23G10.8 Source_evidenceePCR842WS150 Sequence/Annotation Release
Overlaps_Gene C23G10.8 Source_evidenceePCR842WS150 Sequence/Annotation Release
Chunk_score Abs_score779
Max_abs_score779C23G10.8
Specificity_index1
Rel_score1
Map_statusUnique_ePCRIII62034216204362
Overlaps_transcriptC23G10.8 Source_evidenceePCR842WS150 Sequence/Annotation Release
WB_DNA_textTH:340-d8942ctccatagccaccatggataactccatcgattgtcgatcaagtgtttcaatctttcctcgcaatcttgcacaaagcttcataaaaactgctctcaaatcctctggagcaatgctattcagcgcttcctcttgtgtctcgtcgtttactaaattctccacaatatcagtaactttttcatcgtctatagtgaccatgcgtggtgctgtcttgattcgcgtacattgagccattgcttcttgatttccatctttagcgagcaggaaaagtggatctgaaatttgaattcataagttcatttttcttttaaaacaatgactcactaatccacaaggctgtataattccagggttgaagaatatcaaaatattcagatgtcatgaaattttccgttggtgagtttgagcccaaaatagaatcagcagtgagttgaagttcaggcaattgttgaggaaaaacgccttgaagtacaaattctctacgcagttccatgagaatcattccgagacgatttccaccaatataaggaggtctgaaggccattggtcgagtacacaattcgataagctgaagaattttaaattatttctgctaaaatgcctaaatgattaaactaacttgttttgttgtgagatcaacttcttgtagccaatatctgaaatccatttctcgcattcccatacttaattctgcatccatcgatgagaaccgtgaacaataaacgagcattgaatctcccgtgtctaaaagagctcgtaaaagtgcaggatgttgctctaaaagcagctgtagtgattctttaataaattgcattcgtttatccatccaccaagtttgttccaattcgaggccacgtccacgagattcgatgacttcatgaagacgtgaccaacattgaattgaagatggtccttcaaggatgtattcggtatcttcttggttca